1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergejj [24]
4 years ago
6

Which of the following is an example of a limiting factor in a forest?

Biology
1 answer:
Reil [10]4 years ago
8 0

D. Lack of sunlight

Explanation:

In a forest, an example of a limiting factor is that lack of sunlight.

Limiting factors in an ecosystems are the that factors usually made up of environment resources that affects the growth and abundance of organisms in an ecosystem.

  • Examples are sunlight, water, nutrient, air etc
  • In a forest, sunlight is one of the limiting factors.
  • Forest vegetation are stratified.
  • The broad leaved canopy trees dominates and receives the bulk of the sunlight.
  • The undergrowth beneath competes for the little sunlight that reaches below for their own use.
  • Distributions of sunlight in an ecosystem affects the way in which vegetation are dispersed.

learn more:

Rain forest brainly.com/question/12095428

#learnwithBrainly

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Which usually has within it a number of related classes? A. order B. family C. phylum D. species PLEASE HELP
erik [133]
The answer is A) Order
6 0
4 years ago
A neuron transmits information by the secretion of hormones. True or False
grandymaker [24]

Answer:

The given statement is false.

A neuron is the basic structural and functional unit of the nervous system. It helps in transmitting information from one neuron to another neuron, gland, or muscle cell.

The conduction of nerve impulse is electrochemical in nature. It transmits the impulse electrically through the axon the nerve cells and chemically through synapses (gap between two nerves cells).

The axon terminals of pre-synaptic nerve cell release chemical messengers (also called neurotransmitters) in the synaptic cleft. These messengers then bind to the receptors present on the post-synaptic nerve cell and regenerate the nerve impulse.

4 0
3 years ago
Read 2 more answers
A _____ country has high population density.
nadezda [96]

Answer:

A. A Densley populated country.

Explanation:

8 0
3 years ago
Pls hurry im doing an exam Four groups of students plan scientific investigations to answer four questions for the science fair.
mafiozo [28]

Answer:

The correct option is 3

Explanation:

An experimental investigation would require an hypothesis, aim, methodology, results, discussion and conclusion.

The third option can be easily answered using the "requirements" above.

The hypothesis (null hypothesis) would be different types of grass do not affect how far a ball rolls

The aim would be to determine the effect of different types of grass on the movement of a ball

The methodology would involve identifying several playing grounds with different grasses and then rolling the ball with a constant force on the different grasses and then determining the eventual speed and distance traveled by the ball on those grasses which would serve as the results. Inferences can then be made from this results and then conclusions drawn subsequently.

7 0
3 years ago
Other questions:
  • The systems of the body work together and are dependent upon one another. Explain how another system, besides the skeletal syste
    6·1 answer
  • The job of a privacy official is to
    12·2 answers
  • A few months ago, there was a wildfire in a forest. Only a few plants and animals survived the fire. Currently, many trees that
    9·1 answer
  • Which statement correctly compares nucleic acids and carbohydrates? A)They both contain phosphorus, but only nucleic acids conta
    16·2 answers
  • When you listen to your favorite music, what is the order in which the sound approaches and enters your nervous system and is in
    8·1 answer
  • Many mutations in receptor kinases that lead to cancer allow the dimerization and activation of the receptor, even in the absenc
    6·1 answer
  • Explain how artificial selection could lead to a new plant or animal?
    5·1 answer
  • How can pollution travel from one resource to another? Complete the table by describing one example for each set of resources.
    8·1 answer
  • *
    8·1 answer
  • When does fertilization occur?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!