1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr402 [8]
3 years ago
9

Why did mammals evolved so quickly after the extinction of the dinosaurs

Biology
1 answer:
Deffense [45]3 years ago
4 0
Because they started breeding more started coming and there was no big threats
You might be interested in
An inference is A. The same as an observation B. A logical interpretation of an observation C. A statement involving numbers D.
Leona [35]
B. Logical interpretation of an observation
4 0
3 years ago
Genetic drift and natural selection can both be mechanisms of evolution. However, they are very different mechanisms.
Lina20 [59]

Answer:

The key distinction is that in genetic drift allele frequencies change by chance, whereas in natural selection allele frequencies change by differential reproductive success

Explanation:

Hope this helps

PLEASE MARK AS BRAINLIEST !!!

3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
The ------------- and
Grace [21]

Answer:JuiceWrlds death

Explanation: Drugs seizure R.I.P

6 0
4 years ago
Match the items. The task is to match the lettered items with the correct numbered items. Appearing below is a list of lettered
pashok25 [27]

Answer: Non-living factors in an ecosystem.  

2. A large region of land with a distinct climate and certain types of plant and animals.

Explanation:

. Biosphere

b. Biome

c. Population

d. Abiotc

e. Ecosystems

f. Biodiversity

g. Food Chain

h. Aquatic

i. Community

4 0
3 years ago
Read 2 more answers
Other questions:
  • ____ are fungi which obtain nourishment from decaying plants. Saprophytes Spores Hyphae Molds
    15·2 answers
  • What is shifting cultivation​
    11·2 answers
  • What Is The Function of The Digestive System?
    14·1 answer
  • When are lung transplants performed? What are the risks of lung transplants?
    11·1 answer
  • Besides plants what 2 other types of organisms experience plasmolysis
    10·1 answer
  • Proteins that tag pathogens for destruction by immune cells are called
    10·2 answers
  • Which type of diagram illustrates the flow of energy through a group of particular species?
    13·1 answer
  • Eliza wants to increase the yield of her herb garden A friend suggests that Eliza pinch off the tops of the plants as they grow
    6·2 answers
  • What is the optimal temperature for photosynthesis?
    8·2 answers
  • What happens during S Phase?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!