1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina-Kira [14]
3 years ago
5

The development of cars has pros and cons. The car has allowed for better transportation, but it is also responsible for a great

deal of pollution. Which activity can help reduce pollution through the use of new technology?
Biology
2 answers:
ss7ja [257]3 years ago
6 0

Answer:

The correct answer will be running the non-polluting cars.

Explanation:

The technology of a car engine is based on the use of fuels like petrol and diesel which on combustion provides energy to cars. These fuels although provide energy to the running car but produces harmful gases in the environment like SO₂, CH₄, CO AND CO₂.

Nowadays attempts have been made by the scientist all over the globe to find the alternative sources to run the vehicle which can help in reducing the pollution like battery electric vehicles, flexible-fuel vehicles, compressed-air vehicles, hydrogen and fuel-cell vehicles and hybrid electric vehicles.  These vehicles can help reduce pollution and can be a reliable source to depend upon.

Thus, will be running the non-polluting cars is the correct answer.

svetlana [45]3 years ago
3 0

Answer

Developing non polluting cars by developing and using non polluting fuels

Explanation:

Car is one of the fine invention of human being. However, it is considered as polluting because of the fuels used in it which after burning releases harmful gases and dust in the air.

Now a days emphasis is given on sustainable mode and thus petrol and diesel based cars have been restricted from further usage.

Usage of Clean fuel cars   i,e CNG and biofuel cars and electric cars are being encouraged in order to curb the problem of population.

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
What is chlorine and what is the atomic number
atroni [7]
Chlorine-the chemical element of atomic number 17, a toxic, irritant, pale green gas

atomic number-the number of protons in the nucleus of an atom, which determines the chemical properties of an element and its place in the periodic table.
6 0
3 years ago
Suppose that a cell has 20 chromatids at prophase of mitosis. After mitosis and cytokinesis end, the two resulting daughter cell
EleoNora [17]

Answer:

20

Explanation:

Mitosis is a process in which a cell produces an exact copy of itself. The 2 daughter cells produced from mitosis have the same number of chromatids as the parent cell.

8 0
3 years ago
22) moves using an undulating membrane connected to a flagellum
Marrrta [24]

The answer is “Trypanosoma”. The word “Trypanosoma” comes from the Greek words trypanon and soma, which means auger and body, or auger body. A Trypanosoma moves through an undulating membrane connected to a flagellum. Trypanosoma comes from a genus of kinetoplastids, it is known to be a monophyletic cluster of single-celled parasitic flagellate protozoa. 

8 0
3 years ago
According to adam smith, what role does individual self-interest play in directing human activity?
Sladkaya [172]
Adam Smith described self-interest and competition in a market economy as the "invisible hand" that guides the economy. This episode of the Economic Lowdown Podcast Series explains these concepts and their importance to our understanding of the economic system.
7 0
3 years ago
Other questions:
  • When is the lac operon most active?
    14·1 answer
  • One of the most popular taxonomic tools is dna fingerprinting to develop profiles of organisms. these profiles provide direct in
    9·1 answer
  • Why should pregnant women avoid cleaning their cat’s litter box or do so with protective gloves?
    10·1 answer
  • Which of these provides evidence from developmental biology of a shared evolutionary history?
    8·2 answers
  • Which statement explains something that the fossil record indicates?
    12·2 answers
  • What causes the atrioventricular valves to close during a heartbeat? a Pressure in the atria is higher than in the ventricles. b
    7·1 answer
  • How will distinguish between natural and artificial fibres by observing the smell produced when burnt?​
    5·1 answer
  • What is affected by the electrical signal sent by the fourth structure of the reflex arc?(This will be the fifth structure in th
    9·1 answer
  • PLEASE HELP ME WITH THIS!
    14·1 answer
  • A biotech company had discovered in animal experiments that drug A might be helpful in treating insomnia (inability to sleep). A
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!