1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Otrada [13]
3 years ago
8

Oxygen, Carbon Dioxide, fructose, glutamine, sodium ion, potassium ion, protein, and molecule. Which methods of transportation d

o they use? Passive transport, active transport, or endocytosis?
Biology
1 answer:
Mademuasel [1]3 years ago
3 0
The right answer would seem like active transport, hope this helps. let me know in the future if it right thanks.
You might be interested in
Where is sucrose transported to in plants? <br> (name like either roots, leaves, where?)
Anuta_ua [19.1K]
To all parts but particularly u can say phloem sap
4 0
2 years ago
Glycogen. starch, and cellulose are what
AnnyKZ [126]
Glycogen: Glycogen is the principal storage of Glucose. 
Starch: Starch is a carbohydrate consisting of a large number of glucose units joined.
Cellulose: Cellulose is a long chain of linked sugar molecules. 

You're Welcome! want more info, just ask.

3 0
2 years ago
This whole page is worth double
stellarik [79]
1. B 2. C 3.A 4. A molecule is when two or more atoms join together. An element makes up the atoms that form molecules. 5. Similarities include both are cells and each cell are surrounded by cell membranes. 6.A fish is an organism and a rock is not because fish contain the characteristics needed for life, while a rock does not.
7 0
3 years ago
Parents arrive to the clinic with their 5-year-old child and inform the nurse the child has just been diagnosed with sickle cell
nadezda [96]
The parents should go to gene counciling to determine who carried the gene that was passed down to the offspring.
4 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • Which of the following is a eukaryotic cell but not a prokaryotic cell
    14·1 answer
  • Which of the following organisms reproduce sexually via an alternation of generations life cycle? A. algae B. ciliates C. sporoz
    6·2 answers
  • Why a entrophic body of water has high biological productivity
    8·1 answer
  • In each examination room, there are usually ________ waste container(s).
    6·1 answer
  • Cystic fibrosis is a hereditary disorder caused by a recessive mutation. in a previous marriage, jim had a child with cystic fib
    5·2 answers
  • Humans and gorillas have one different amino acid in their hemoglobin sequence. What does this say about the evolution of these
    6·2 answers
  • Which of the following best describes what causes water molecules to exhibit properties such as cohesive and adhesive behavior?
    14·2 answers
  • Didn’t know about this one
    6·1 answer
  • Sally has a difficult time understanding language. her words and sentences are not clearly understood and the sentences she does
    6·2 answers
  • Which of the following processes provides the link between solar energy and multi-cellular life on earth?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!