1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serg [7]
2 years ago
9

Which of the following statements are false?

Biology
1 answer:
bixtya [17]2 years ago
3 0
The second one is worng
You might be interested in
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
olchik [2.2K]

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

8 0
3 years ago
Why is it important that cell membranes are semipermeable?
ElenaW [278]
So we can maintain homeostasis. Cell membranes help us sweat to cool us off.
3 0
2 years ago
If you are interested in the evolutionary relationship of animals that have four limbs, which of the following would be the outg
trapecia [35]

Answer:

  • First outgroup → Ray-Finned Fishes
  • Second outgroup → Sharks

Explanation:

The outgroup is the most distant taxonomic group that shares no traits or characters with the lineages of interest, which compose the ingroup. You can compare the outgroup with the ingroup to determine the evolutive relationship and which characters are primitive or derived.    

Even though the outgroup shares a common ancestor with the ingroup, this is placed far away in evolution, making the outgroup to be the taxonomic group less related to the other lineages. The lineages in the ingroup share another common ancestor that is more recent in history.

To select the outgroup, you need to focus on what you are interested in. There might be several outgroups, but you should choose the one that is more related or closer to the ingroups. This selection is important because you need to make comparisons to understand the evolution of specific traits.  

In the exposed example, we need to focus on animals that have four limbs. Then, we might assume that the ingroup is composed of Amphibians Crocodiles Dinosaurs. Sharks and Ray-Finned Fish do not have four limbs, so they might be considered outgroups.

From these two outgroups, sharks have a cartilaginous skeleton, while Ray-Finned Fishes have a bony skeleton. This fact makes ray-finned fishes more related to the ingroup than the sharks. So,

  • First outgroup → Ray-Finned Fishes
  • Second outgroup → Sharks

8 0
2 years ago
True/False: Plant Viruses can only infect plant cells
Ratling [72]

Answer:

true

Explanation:

6 0
2 years ago
Read 2 more answers
Which of these provides an example of molecules moving by facilitated diffusion?
iVinArrow [24]

Answer:D

Explanation:

7 0
2 years ago
Other questions:
  • Where does the chemical energy to convert ADP to ATP come from?
    5·1 answer
  • Isometric exercise strengthens muscles without __________.A.contracting muscle fibersB.changing muscle lengthC.burning caloriesD
    8·1 answer
  • Multiple Choice
    12·1 answer
  • Why is S phase of the cell cycle important?
    12·1 answer
  • I am confused with this question
    7·2 answers
  • Identify which of the blood vessels are red in color and expanding why
    8·1 answer
  • Help please anyone thank you ?!!!!!(((:
    13·1 answer
  • Which of the following processes are involved in the loss of water from the leaves of plants?
    9·1 answer
  • Choose all of the correct answers. the mechanisms through which evolution takes place are related to a set of processes that inc
    11·1 answer
  • Why does the nurse need to keep the urine sterile while obtaining a sample from an indwelling urinary catheter?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!