Answer:
According to the number of sequence on DNA there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.
Explanation:
DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-
GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-
GAG UUU AUC CCC AAC UUG GCA UAA GGU AGG-
Glutamine, Phenylalanine, Isoleusine, Proline, Asparagine , Leucine, Alanine, stop codon. As ribosome reach on stop codon protein synthesis stopped and process aborted.
So we can maintain homeostasis. Cell membranes help us sweat to cool us off.
Answer:
- First outgroup → Ray-Finned Fishes
- Second outgroup → Sharks
Explanation:
The outgroup is the most distant taxonomic group that shares no traits or characters with the lineages of interest, which compose the ingroup. You can compare the outgroup with the ingroup to determine the evolutive relationship and which characters are primitive or derived.
Even though the outgroup shares a common ancestor with the ingroup, this is placed far away in evolution, making the outgroup to be the taxonomic group less related to the other lineages. The lineages in the ingroup share another common ancestor that is more recent in history.
To select the outgroup, you need to focus on what you are interested in. There might be several outgroups, but you should choose the one that is more related or closer to the ingroups. This selection is important because you need to make comparisons to understand the evolution of specific traits.
In the exposed example, we need to focus on animals that have four limbs. Then, we might assume that the ingroup is composed of Amphibians Crocodiles Dinosaurs. Sharks and Ray-Finned Fish do not have four limbs, so they might be considered outgroups.
From these two outgroups, sharks have a cartilaginous skeleton, while Ray-Finned Fishes have a bony skeleton. This fact makes ray-finned fishes more related to the ingroup than the sharks. So,
- First outgroup → Ray-Finned Fishes
- Second outgroup → Sharks