1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mamaluj [8]
2 years ago
11

How much greater are the negative effects of depression, anxiety, substance abuse and cognitive difficulties including memory is

sues for older adults who have lost a spouse than other older adults who have not lost spouses?
Biology
1 answer:
Tamiku [17]2 years ago
7 0

Answer:

The negative effects are much greater for older adults who have lost a spouse than other older adults who have not lost spouses.

Explanation:

The effects are felt much greater for older adults who have lost a spouse due to it being compounded on the grief that the older adult is feeling from the loss of their spouse. Also the absence of the spouse brings forth a sense of loneliness and a loss of companionship, thus further amplifying the negative effects being inflicted.

You might be interested in
Why should someone support organ donation?
torisob [31]

Answer:

By donating your organs and tissue after you die, you can save or improve as many as 75 lives. As many people are waiting for transplants

Explanation:

helping/improving lives is good

4 0
3 years ago
Read 2 more answers
In a water molecule the electrons are not equally shared , creating a ____ molecule .
zalisa [80]

Answer:

Polar

Explanation:

In a water molecule, the oxygen atom is bigger and has a greater pull on the electrons than the hydrogen atoms do. This makes the molecule polar.

3 0
2 years ago
How many fins do perch have? Name them:
Alona [7]
Perch have paired pectoral and pelvic fins, and two dorsal fins, the first one spiny and the second soft. These two fins can be separate or joined.
4 0
2 years ago
Botulism is caused by ingestion of a proteinaceous exotoxin; therefore, it can easily be prevented by
hammer [34]

Botulism can easily be prevented by boiling food prior to consumption.

<h3>What is Botulism?</h3>

Botulism may be defined as an imperative food poisoning that is provoked by botulinum toxin delivered in food by a bacterial species clostridium botulinum.

Clostridium botulinum inhibits the release of acetylcholine in the neuromuscular junction and causes defects in sensory perception through the central nervous system.

It can only be prevented by taking the proper boiled food prior to consumption.

The complete question is as follows:

  • boiling food prior to consumption.
  • administering antibiotics to patients.
  • not eating canned food.
  • filtering food.
  • preventing fecal contamination of food.

Therefore, the correct option for this question is A, i.e. boiling food prior to consumption.

To learn more about Food poisoning, refer to the link:

brainly.com/question/2192816

#SPJ1

4 0
1 year ago
When a kidney is cut lengthwise, three distinct regions become apparent. the outer region is light in color, while the deeper "m
Temka [501]
There are three main regions of the kidney.
<span>1.Renal cortex -  It is the outer region of the kidney which contains the renal corpuscles and the renal tubules (without the loop of Henle). It produces the erythropoietin.</span>
<span>2.Renal medulla  - It is the innermost part of the kidney which contains the renal pyramids.</span>
<span>3.Renal pelvis  -  It is the region that collects urine from the nephrons, thus it contains the place where ureter leaves the kidney.</span>
6 0
3 years ago
Other questions:
  • what is the probability that a cross between parents who are both homozygous recessive trait will have offspring that are homozy
    6·2 answers
  • How does the circulatory system work at the organ level?
    14·2 answers
  • Which of the following best completes the hypothesis?
    11·2 answers
  • Dr. Wright believes that heredity is primarily responsible for personality traits. Dr. DeJong believes that environmental influe
    7·1 answer
  • Neurons are highly specialized cells that have lost the ability to divide.what phase are neurons in?
    5·2 answers
  • #1 The water held back by a dam is an example of which type of energy?
    5·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Study the food web above. The proliferation of which organism would MOST negatively affect food production for
    10·2 answers
  • Lauren has cystic fibrosis. Her body is unable to control the flow of salt into and out of her cells. Lauren's symptoms include
    11·2 answers
  • If the mass of an object increases, what also increases
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!