1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
3 years ago
15

What kind of molecule passes through the lipid belayer of the cell membrane

Biology
1 answer:
Ronch [10]3 years ago
3 0
Usually small Nonpolar molecules and further small molecules easily can pass through the lipid bilayer of the cell membrane. Larger molecules, polar and ionic substances require the use of specific proteins to help with movement across the membrane.
You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
In oxidation,
Romashka [77]
In oxidation, oxygen is needed to create a chemical reaction.
5 0
2 years ago
Alma brought her 6-month-old son to the doctor for a well-baby visit. The doctor says that her son's weight is in the 20th perce
sveta [45]

This means that her son is small compared to other 6 month old children.

A percentile is a measure between 0 and 100 that compares children of similar age in order to know if a particular child is growing well. The higher the percentile number, the bigger the child is compared to other children of same age. If a child is in the 50th percentile for height, it means the child is in the middle of the pack.



5 0
3 years ago
If a cell contains 95% water and is put into a beaker with 100% water, what will happen
Kisachek [45]

Answer: The quantity of water in the beaker will reduce. The cell will increase size.

Explanation: There is difference in water concentration between the cell and the beaker, therefore water will move from the beaker into the cell causing the cell to expand and the quantity of water in the beaker to decrease. There will be movement of water molecules from an area of high water concentration (beaker) to an area of low water concentration (the cell) through a selectively permeable cell membrane. The aim of this is to create an equilibrium between the water concentration in the cell and that in the beaker.

4 0
3 years ago
Why is it important to ensure that a downed game animal has expired before approaching it?
andriy [413]
I need help with health
7 0
3 years ago
Read 2 more answers
Other questions:
  • In order for cellular respiration to occur, oxygen and __________ are necessary. glucose atp carbon dioxide water
    8·1 answer
  • Which energy source does not originate from the sun?
    8·1 answer
  • Which statement describes gravity, There is no define of measurement for gravity, Gravity is the force that pulls objects toward
    11·2 answers
  • Which of the following is a disadvantage to the coal-to-liquid production of synthetic fuels
    9·1 answer
  • What do you need to use in order to work as an environmental scientist?
    15·2 answers
  • What stage of cellular respiration does not involve any carbon-based compounds as a reactant or product? A. Electron transport c
    14·2 answers
  • What is the special life force in the air called that people used to think created microbes?​
    15·1 answer
  • This is a form of weather characterized by lightning and large amounts of rainfall.
    15·1 answer
  • A researcher has hypothesized that the chemical tributyltin (an additive in boat paint) seeps into the water causing reproductiv
    11·1 answer
  • Question 10 5 pts Live or Die challenge (multiple answers): you are walking in the woods just with water and a Black Bear lookin
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!