1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bas_tet [7]
3 years ago
13

Inside a shoe factory, there is a boss that tells the employees how to make different kinds of shoes. There is a door, where the

leather to make shoes comes in and finished shoes come out. There are machines that actually make the shoes.
Which organelle does the boss represent?
Biology
1 answer:
Galina-37 [17]3 years ago
8 0

Answer:

Mitochondria

Explanation:

You might be interested in
g A mutation occurs upstream of gene A in the region encoding the ribosome binding site, making it bind more weakly to the ribos
Ivanshal [37]

Answer:

it is expected that the mutation results in a reduced initiation of translation and thereby decreasing the level of the protein A, while it does not change the level of mRNA A

Explanation:

Translation in bacteria starts with the formation of the initiation complex which is composed of the small ribosomal subunit, the messenger RNA (mRNA), initiation factors and the initiator transference RNA (tRNA) containing N-formyl-methionine. The small ribosomal subunit binds to a polypurine stretch of variable length in the mRNA called 'the Shine-Dalgarno sequence'. A mutation in this sequence reduces the affinity of the ribosome for the mRNA, thereby, in this case, decreasing the level of protein A. Since transcription occurs before translation, it is expected that this mutation does not change the level of expression of the mRNA A.

4 0
3 years ago
MARKING PEOPLE AS BRAINLIDT IF CORRCET
meriva

Answer:

True the bone cells do have different DNA than blood

Explanation:

3 0
3 years ago
Read 2 more answers
Write a paragraph describing a unicorn, what it looks like, and where it lives. Think of any inherited traits the species has th
slavikrds [6]

Answer:

A unicorn is a mythical creature that resembles a horse with a horn on its forehead. The unicorn could use its horn for self-defense. Some unicorns might also have wings so they could help the unicorn survive by escaping predators quickly. W could be for a winged unicorn (dominant) and w would be a unicorn without wings (recessive). L could be for a long unicorn horn, and l could be for a short horn. C would be a lighter fur color and c would be a darker fur color. That's all I could come up with for now :)

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What is the name of the type of puller that uses a heavy weight that is slid against its handle?
svlad2 [7]
A slide hammer puller. A slide hammer puller can be used to pulll a bearing from a bored hole that is pressed into. They are adjustable with either a collet or puller jaws. To remove the bearing, slide the weight back hard until it hits the flat area on the rear of the puller.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Shell orientation in snails is due to a maternal effect gene. A true breeding sinistral (recessive) is crossed to a true breedin
    8·1 answer
  • What example is lactose and cellulose
    10·1 answer
  • Describe the action mechanism of labile toxin by placing the steps in the correct order.
    13·1 answer
  • The amount of matter that cycles through a food web
    5·2 answers
  • All of the following statements about neutrons are true except
    13·1 answer
  • Describe how the largest island of Hawaii has areas that are representative of various biomes.
    6·2 answers
  • Give two examples of a food chain within the food web
    15·1 answer
  • Compare and contraste the 5 main climate types
    6·1 answer
  • Which of the following statements about soil formation is true?
    12·2 answers
  • What are 2 non-example of potential energy ?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!