1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hammer [34]
4 years ago
8

Prostaglandins: A. stimulate smooth muscle contraction. B. have four-membered rings and are derived from arachidonic acid. C. ar

e a subset of leukotrienes. D. inhibit the aggregation of platelets. E. inhibit inflammation.
Biology
1 answer:
nevsk [136]4 years ago
4 0

Answer:

The correct answer is option A, that is, stimulate smooth muscle contraction.

Explanation:

A group of lipids and a hormone that plays an essential role in monitoring the process of the formation of blood clots, stimulation of labor, the flow of blood and inflammation is known as prostaglandins. The hormone prostaglandin takes part in various kinds of body functions like the relaxation and contraction of the smooth muscles at the time of childbirth, monitoring blood pressure, dilation and constriction of blood vessels, and produce inflammation at the site of infection or tissue damage.  

Prostaglandins possess five-membered rings and are obtained from the fatty acid, arachidonic acid. At the time of blood vessel injury, thromboxane, that is, a form of prostaglandin enhances the process of blood clot formation so that the injury site gets heal quickly.  

You might be interested in
A multigravid client admitted to the labor area is scheduled for a cesarean birth under spinal anesthesia. Which client statemen
Gekata [30.6K]

Answer:The anesthetic may cause a severe headache, which is treatable."

Explanation:

Spinal anesthesia is a type of anesthesia which is administered locally using a fine needle between L3 and L4 space or L4 and L5 space in order to avoid injury to the spinal cord. This procedure is usually carried out by a trained health personnel such as:

- a nurse anesthetists and

- anesthesiologists

Spinal anaesthesia can be used in different surgical procedures such as Caesarea sections and to manage pain during vaginal delivery in MULTIGRAVID CLIENTS, which are those clients who has been pregnant more than once.

Caesarean section is usually done while the patient is awake with the use of spinal anaesthesia. Therefore it's important to explain any possible side effects from the drug to the patient which includes a severe type of headache called post-spinal headache and it's treatable.

3 0
3 years ago
Which organelles are found in plant cells but not in animal cells?
Valentin [98]

Answer:

Organelles that are found in plant cells, and not in animal cells, are chloroplasts, a call wall, specialized plastids, and a large central vacuole.

Hope you found this helpful <3

8 0
3 years ago
Read 2 more answers
How many grams of aluminum hydroxide are obtained from 16.2 g of aluminum sulfide?
nadezda [96]
Number of moles Aluminium sulfide
1 mole of sulfide contains 150 g
Therefore; 16.2/150 
               = 0.108 moles 
The mole ratio of Al2S3 : Al(OH)3 is 1:2
Therefore; moles of Aluminium hydroxide will be;
  = (0.108 × 2)
  = 0.216 moles 
But, 1 mole of  Al(OH)3 contains 77 g
Therefore, the mass of aluminium hydroxide is
   0.216 moles × 77
=  16.632 g
8 0
3 years ago
All the interconnected feeding relationships in an ecosystem make up a food
mamaluj [8]

The answer is B, Chain!

3 0
3 years ago
Read 2 more answers
Determine tRNA anticodons<br> UACCUGUUAAGCUACAAAAUU
Pavel [41]

Answer:

i dont know sorry , Gooqle it

7 0
3 years ago
Other questions:
  • What is a ligand? what do ligands have to do with receptor-mediated endocytosis?
    14·1 answer
  • Red meat contains
    13·1 answer
  • More than one globular or fibrous protein subunit now interact to produce ____________ structure, which results from ionic, hydr
    5·1 answer
  • Which is used to create copies of genetic material for DNA fingerprinting?
    13·1 answer
  • What is an abstract?
    15·1 answer
  • What are the two main categories of ecoystem
    9·1 answer
  • Which of the following is true of crossing over? It involves the exchange of chromosome segments between homologous chromosomes.
    11·1 answer
  • A child has a blood type of O. Can the mother of that child have a blood type of AB?
    7·2 answers
  • Explain how increased energy efficiency is beneficial.
    7·2 answers
  • HELP THIS IS DUE TODAY I WILL MARK U AS THE BRAINLIEST ANSWER!!
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!