Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
Answer:
In passive transport, substances simply move from an area of higher concentration to an area of lower concentration, which does not require the input of energy. Concentration gradient, size of the particles that are diffusing, and temperature of the system affect the rate of diffusion.
It occurs without energy input. Passive transporters let something across a membrane "with the gradient" in other words, substances travel from high concentration to low concentration, which is energetically favorable.
Since there was already an anti resistant microorganisms that actuallly have been able to survive through the antibiotics, natural selection states that if one survives and is well adapted to a certain environment, then offspring from that survivor will be created and beneficial traits for the offspring will be received having them a chance for survival. So, the microorganisms spread and spread offspring with that anti resistance in which is the Survival of the Fittest. Until there are no microorganisms that aren’t resistant the lastahas strep throat then returns.
Hope this helps!:)
So every organism is individually classified without the worry of mixing up two organisms like a fly and nat.
