Poor sanitation is not something that only happens in faraway places, it is also something that happens close to home and often
1 answer:
You might be interested in
Chromosomes are composed of deoxyribonucleic acid (DNA) mole
There are mainly two molecules that function as genetic material in living organisms.
These are ribonucleic acid(RNA) and deoxyribonucleic acid(DNA).
The organisms having DNA as genetic material require packaging of DNA as it is a long polymer of deoxyribonucleotides.
In the case of human beings, the length of DNA in a cell is approximately 2.2 meters which is very large as compared to the size of the nucleus( approximately 10^-6 meters).
So, the DNA has to be made compact for it to be present inside the nucleus of a cell.
Therefore, the DNA present inside the nucleus of a cell undergoes coiling and compaction through several stages before finally becoming a chromosome, which is shown in the adjoining diagram.
Thus, chromosomes are composed of deoxyribonucleic acid (DNA) molecules.
To know more about "DNA Packaging", refer to the following link:
brainly.com/question/14702559?referrer=searchResults
#SPJ4
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
