1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkinab [10]
3 years ago
10

What are compounds? A. homogeneous mixture B. heterogeneous mixture C. pure substances

Biology
2 answers:
MAVERICK [17]3 years ago
8 0
What are compounds? <span> A. homogeneous mixture
B. heterogeneous mixture
C. pure substances


A compound is a pure substance mixture.  </span>
sammy [17]3 years ago
6 0
C. pure substances
Hope this helps.
You might be interested in
4. How do scientists know that other cell structures exist?
kipiarov [429]

Answer:

With an electron microscope

Explanation:

thats it

3 0
2 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Help me. I will give brainIiest and high points.
Sonja [21]

Answer:

Mutualism

I think.

4 0
3 years ago
Read 2 more answers
What is the correct order of the stages of Mitosis?
astraxan [27]
Check the photo I sent for answer

5 0
3 years ago
Describe how anemia and leukemia affect the blood.
Vaselesa [24]
Anemia- The Bone Marrow stops making red and white cells and platelets for the body.

People with severe or very severe are in risk of life threathing infections and bleeding.

Leukemia- Is a cancer to blood or bone marrow .Large numbers of white cells are produced in the bone marrow and crowd it and the bloodstream and they cannot perform the proper role of protecting and fitting against diseases.Blood has to go everywhere to bring to body what it needs, making it a stuff cancer.

Major progress and been made targeting this cancer, take the blood out of the body, separate your cancer blood from your good blood, better ways to kill only the bad blood, make more good blood faster, relax your body, mind, improved immune system.
8 0
3 years ago
Other questions:
  • Raven is planning a vacation. She wants to go somewhere warm and sunny on her trip because her hometown experiences harsh winter
    6·2 answers
  • How to make a great inferens in science questions ?
    9·1 answer
  • Serves as a long-term storage area for water or nutrients.
    14·1 answer
  • If the sun grew much stronger in intensity, how would the water cycle be affected?
    8·1 answer
  • In an exothermic reaction, the products in the activation energy curve are located ________ the reactants.
    15·1 answer
  • What part of the DNA is responsible for the inheritance of trait
    12·1 answer
  • Heat is necessary for water to: A- precipitate<br> B- condense <br> C -form dew <br> D- evaporate
    15·2 answers
  • What does mRNA do?
    12·1 answer
  • NO LINKS AS AN ANSWER
    14·2 answers
  • Which describes the smallest basic unit of a substance that still displays the properties of that substance? Which describes the
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!