1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DerKrebs [107]
3 years ago
8

Wanda is in labor. Which hormone is causing her uterus to contract for childbirth?

Biology
2 answers:
gladu [14]3 years ago
4 0
Oxytocin strengthen labor contraction during childbirth
Anvisha [2.4K]3 years ago
4 0

Answer:

Oxytocin Hormone

Explanation:

It is the oxytocin which is mainly responsible for contraction of womb along with lactation during child birth.

The muscles of uterine are stimulated by the oxytocin to release prostaglandins and cause further contraction.

Oxytocin also stimulates cervix  ripening  thereby leading to successive dilation during labour however Oxytocin, suring this time help in maintaining the  high levels of oestrogen.

You might be interested in
A classmate states that animals that result from artificial selections are lucky since they have better traits than bred animals
Delvig [45]

Answer:

See answer below. Hope it helps.

Explanation:

This can have advantages and disadvantages. The artificially selected animals could have better traits than naturally selected animals, but in the long run, it will be harder for them to evolve and adapt to new environments because of the lack of variation in their traits.

3 0
2 years ago
please someone help me with this: a mineral's____________shape is determined by its actomic structure.
bogdanovich [222]

I believe the answer is a mineral's crystal shape is determined by its atomic structure.

4 0
3 years ago
Read 2 more answers
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
nydimaria [60]

I don see the question if there is one can you explain and ill edit my answer to best fit

8 0
3 years ago
Scientist believe that the function of a hiccup in the human body could be all of the following except for:
maria [59]
In this whole little thing you got going its a
6 0
3 years ago
What possible offspring genotypes and probabilities for each can be generated by an Aa parent through selfing?
GenaCL600 [577]

.75. 75% A because is is a dominant gene. a is 25% because it is recessive, and is mostly overcome by a dominant gene.

6 0
3 years ago
Other questions:
  • What is an epitope? the complementarity-determining regions of lymphocyte receptors the portion of an antigen that binds covalen
    10·1 answer
  • To accelerate a 3 kg skateboard at 9 m/s2 a how much newtons are needed?
    12·1 answer
  • Which of the following describes a phenomenon that occurs when we observe plants that wilt?
    6·2 answers
  • Explain how heat is loss underwater. <br><br>Make explanation as short as possible. ​
    9·1 answer
  • Which statement best describes the process by which the millions of body cells that form a housefly can all contain the same gen
    5·1 answer
  • A scientist crossed two pea plants, both having the genotype RrYy. The Punnett square representing the cross is shown in the tab
    15·1 answer
  • Which animals typically have a reproductive group and a nonreproductive group within their social structure?
    10·1 answer
  • Please help answer these questions for biology
    7·1 answer
  • Do cells divide all the time
    14·1 answer
  • Hi I want to make sure this is right, I have a doubt on the last answer too. thank you
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!