Define homeostasis autotroph and mitochondria

2 answers:

5 0

Homeostasis - the tendency toward a relatively stable equilibrium between interdependent elements, especially as maintained by physiological processes.
autotroph - An organism that manufactures its own food from inorganic substances, such as carbon dioxide and ammonia.
mitochondria - an organelle found in large numbers in most cells, in which the biochemical processes of respiration and energy production occur. It has a double membrane, the inner layer being folded inward to form layers (cristae).

Hatshy [7]3 years ago

3 0

Homeostasis is the equilibrium of a cell.

Autotrophs make their own food through photosynthesis.

Mitochondria undergoes cellular respiration and is often referred to as the "powerhouse of the cell".

You might be interested in

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′

Blizzard [7]

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

4 0

4 years ago

Dr. Kavanaugh has noticed that many of her students are having difficulties understanding the basic parts of a nerve cell (neuro

wel

Answer:

Hypothesis