1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena-s [515]
3 years ago
7

in eukaryotes, genetic material is packaged in the nucleus. which group accurately lists the levels of the packaging in order of

increasing size?
Biology
1 answer:
vredina [299]3 years ago
8 0

The DNA molecules are often fitted into the nucleus through packaging into a compressed and compact structure. The group that accurately lists the levels of the packaging in order of increasing size are nucleotide, DNA duplex, nucleosome, chromatin, chromosome.

Chromosomal DNA is often packaged into a nuclei that is microscopic in nature through the help of histones.

In the DNA packaging inside the nucleus, the cells folds or wrap their DNA strands around scaffolding proteins to form a coiled condensed structure. The structure is known as chromatin.

The full question is below

Which one of the following MOST accurately lists the components in order of increasing size?

A. chromosome, chromatin, nucleosome, DNA duplex, nucleotide

B. nucleotide, DNA duplex, nucleosome, chromatin, chromosome

C. nucleotide, DNA duplex, chromatin, nucleosome, chromosome

D. nucleotide, nucleosome, DNA duplex, chromatin, chromosome

E. chromosome, nucleosome, chromatin, DNA duplex, nucleotide

Learn more from

brainly.com/question/10194046

You might be interested in
Describe two ways in which lava flows can be controlled
Sophie [7]
<span>Carve a new path in the landscape to diverge the lava or spray water on it if its near a river to cool it down



</span>
8 0
3 years ago
Read 2 more answers
PLZ help ASAP!!!!!!!<br> WILL MARK BRAINLIEST FOR ONLY THE CORRECT ANSWER
Nadya [2.5K]

Answer:

DNA or RNA: Nucleic acid

Starches and sugars: Carbohydrates

Antibodies: Proteins

Can be utilized for energy if sugars are not available: Lipids

Hydrophobic part of the plasma membrane: Lipids

Glucose and sucrose: Carbohydrates

Explanation:

The DNA or RNA can be described as molecules made up of nucleic acids.

Carbohydrates can be described as biological molecules made up of carbon, hydrogen and oxygen. For example, starches, sugars, glucose, sucrose etc

Antibodies can be describe as a type of proteins which provide the body with immunity.

Lipids or fats are the alternative source of energy if carbohydrates are not present.

The hydrophobic tail of the plasma membrane is made up of fatty acid molecules which are lipids.

5 0
3 years ago
Question 5 what organisms have an open circulatory system? fish frogs mammals insects birds
katrin [286]
Crustaceans, insects, spiders, lobsters, clams, etc.
5 0
3 years ago
Where are the anti-biotics the most concentrated?
Hatshy [7]
Bacterial responses to antibiotics are concentration-dependent. At high concentrations, antibiotics exhibit antimicrobial activities on susceptible cells, while subinhibitory concentrations induce diverse biological responses in bacteria.
6 0
2 years ago
What does natural selection favor?​
ratelena [41]

Answer:

The mechanism that Darwin proposed for evolution is natural selection. Because resources are limited in nature, organisms with heritable traits that favor survival and reproduction will tend to leave more offspring than their peers, causing the traits to increase in frequency over generations.

The reason that natural selection is important is that it's the central idea, stemming from Charles Darwin and Alfred Russel Wallace, that explains design in nature. It is the one process that is responsible for the evolution of adaptations of organisms to their environment.

Explanation:

hope this helps

3 0
3 years ago
Other questions:
  • Puberty is defined as ________. the production of hormones in the reproductive glands stimulated by the pituitary gland the stag
    11·2 answers
  • The fact that little albert learned fear toward not only a white rat but also a ball of wool and a rabbit represents:
    8·1 answer
  • If you wanted to increase the rate of photosynthesis in a plant, you would develop a plant with which of the following character
    13·2 answers
  • Describe how enzymes and substrates are related
    9·1 answer
  • The specific heat of iron is 0.11 cal (g°C) . A cafeteria fork made of iron has a mass of 20 grams. How much heat energy is need
    9·2 answers
  • Water and nutrients that are not cycled are stored in a
    13·2 answers
  • The patient is recovering from hypovolemic shock. The nurse hangs a bag of normal human serum albumin (Albutein) and educates th
    8·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • i will mark u brainliest!!! What is on the biology module 4 dba? pleasee only leave real answers im struggling lol.
    7·1 answer
  • The study of how gene expression is turned on and off and which considers the
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!