1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ICE Princess25 [194]
3 years ago
6

Describe two features of adaptive plasticity (in the brain)​

Biology
1 answer:
andrey2020 [161]3 years ago
3 0

Brain plasticity refers to the capacity of the nervous system to change its structure and its function over a lifetime, in reaction to environmental diversity. ... Neuroplasticity, or neural plasticity, allows neurons to regenerate bothanatomically as well as functionally, and to form new synaptic connections.

You might be interested in
What is the basic unit of matter A.atomB.bacteriumC.cellD.molecule
erma4kov [3.2K]
An atom is the most basic unit of matter
6 0
3 years ago
Read 2 more answers
How does an increased population size affect the amount of competition between organisms?
zmey [24]
Competition will increased because more organisms will be competing for resources
5 0
3 years ago
Which organelles is made of microtubules that functions during cell division?
dezoksy [38]
I think it's centrioles
6 0
3 years ago
What causes a greater amount of pressure in the inner core?
astraxan [27]
It turns out that many materials can be solid at a higher temperature if the pressure is also higher. so even though it is hotter in the inner core the pressure in the core is also higher and you can have a solid iron nickel instead of liquid
6 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • The nurse is required to administer vitamin k to a term newborn. how should the nurse administer this injection
    13·1 answer
  • Why are olfaction and gustation called chemical senses? Neither one has sensory receptors that respond to molecules in the food
    6·1 answer
  • Which of the following is a sac fungus?
    14·2 answers
  • Cells use different processes at different times to provide an organism with the energy that it needs. Spirulina is an autotroph
    11·1 answer
  • Whats the definition of biochemical charecters​
    14·1 answer
  • Need help with earth science
    5·1 answer
  • According to the theory of evolution what causes living things on earth to change over time
    7·1 answer
  • Write a good paragraph about what you already know about Earth’s air, water, solid Earth, and life on Earth. Please use complete
    8·1 answer
  • In peas yellow seed color y is dominant to green seed color y ​
    13·1 answer
  • NEED ANSWERS IN 5 MINUTES, PLEASE <br><br> List two examples of diffusion in living organisms
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!