1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rudik [331]
3 years ago
10

Veins carry blood ________ the heart.

Biology
1 answer:
Allisa [31]3 years ago
5 0
Veins carry blood B. TOWARDS the heart. 
The blood is from the body.

Arteries are blood vessels that carry the blood from the heart towards the body.

Veins are major blood vessels that carry blood towards the heart. The pulmonary veins carry blood from the lungs to the left side of the heart. The superior and inferior vena cavae are large vessels that carry oxygen-poor blood from the body to the heart.

You might be interested in
What is a carbon foorprint
Alex Ar [27]

Answer:

Definition: The amount of carbon dioxide and other carbon compounds emitted due to the consumption of fossil fuels by a particular person, group, etc.

6 0
3 years ago
In a litter of kittens, some of the kittens have coloring that is completely different from their parents. What is the explanati
Snowcat [4.5K]
The placement of the genes on the parent chromosones - B.

<span>The reason for this is that if the parents of the kittens are heterozygotic individuals (Pp and Pp). Where P being one colour and p being another colour, it's quite possible that some of their litter have the pp allele combination which in turn could make them a different colour. </span>
8 0
3 years ago
Read 2 more answers
Prior to entering the Krebs Cycle, each pyruvate molecule loses electrons, hydrogen ions, and a carbon, forming an energy-rich m
gulaghasi [49]

Answer:

a. Acetyl-CoA

Explanation:

Pyruvate is decarboxylated in the matrix of mitochondria and loses its carbon as CO2. This decarboxylation is accompanied by its oxidation as well. This process of oxidative decarboxylation of pyruvate is catalyzed by an enzyme complex. It is called the pyruvate dehydrogenase enzyme complex. NAD+ accepts the released electrons and pyruvate is converted into energy-rich acetyl CoA which in turn enters into the Kreb's cycle.

5 0
3 years ago
When a reaction releases more energy than it uses, it is called (1 point)
aliya0001 [1]

Answer:

<h2>option b exothermic </h2><h3>explained here </h3>

Explanation:

Chemical reactions that release energy are called exothermic. In <u>exothermic</u><u> </u>reactions, more energy is released when the bonds are formed in the products than is used to break the bonds in the reactants. ... Endothermic reactions are accompanied by a decrease in temperature of the reaction mixture.

<h2>hope it helps please give brainliest plz follow </h2>
7 0
3 years ago
Read 2 more answers
A closed system is best characterized as a system in which: (3 points)
Anarel [89]

Answer:

A closed system is a physical system that does not allow transfer of matter in or out of the system, though, in different contexts, such as physics, chemistry or engineering, the transfer of energy is or is not allowed.

7 0
3 years ago
Other questions:
  • A person may have two conflicting attitudes. <br> T/F
    6·2 answers
  • Oceanic crust is best described as
    13·2 answers
  • which of the following is a correct statement about the events of the cell cycle? 1)Little happens during the G1 and G2 phase. 2
    7·1 answer
  • What evidence indicates that the cell must be a plant cell
    12·2 answers
  • What are some proposed disadvantages to utilizing DNA technology? Check all that apply.ANSWER IS (reduced effectiveness of pesti
    9·1 answer
  • Although the exact number of genes in human DNA is unknown, scientists estimate the number to be around 20,000 to 25,000.
    11·2 answers
  • Which phrase best describes osmosis? A. the process by which the cytoplasm physically divides B. the process of DNA synthesis C.
    5·2 answers
  • Humans and mice have similar genomes. In fact, researchers have found thousands
    11·1 answer
  • Which of the following is the relatively largest type of organism?
    10·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!