1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natka813 [3]
3 years ago
7

What are the 3 patterns of surface processes

Biology
2 answers:
snow_tiger [21]3 years ago
8 0
Cratering, Erosion, Volcanoes and Weathering
Alisiya [41]3 years ago
7 0
Water continually cycles among land, ocean, and atmosphere via transpiration, evaporation, condensation and crystallization, and precipitation, as well as downhill flows on land. changes in form are propelled by sunlight and gravity.
You might be interested in
How long does a lunar eclipse last?<br><br> Months<br> Minutes<br> Days<br> Weeks
Sergio039 [100]
A lunar eclipse can last for a couple of hours and some minutes
8 0
3 years ago
How does vacuole impact the community
IRINA_888 [86]
Hello,

Here is your answer:

The proper answer to this question is "vacuoles are used to clean the cell for example a child cleaning his or her room they would put his or her toys into a closest and that was a vacuole does it cleans up things in a cell and keeps them stored into there like a closest".

If you need anymore help feel free to ask me!

Hope this helps! 
4 0
3 years ago
What are some causes of cancer
andrew-mc [135]

Answer:

There are a bunch of things.

Explanation:

Smoking and Tobacco.

Diet and Physical Activity.

Sun and Other Types of Radiation.

Viruses and Other Infections.

Hope this helps!

6 0
2 years ago
Read 2 more answers
Many body systems work together for proper functioning of the body and to maintain internal homeostasis.
jeyben [28]

Answer:

your questions is not exactly sure but make sure your questions

3 0
2 years ago
What kind of math is used to solve one time pad?
Mnenie [13.5K]

Answer: i know it not the answer

Explanation:

What is one time pad?

The one-time pad (OTP) is a theoretically unbreakable cipher. However, in practice it is of limited usability because it requires a pre-shared key of at least the same length as the message. This tool helps you encode or decode one-time pads if you have the key.

About Math Pad. MathPad is a tool for students to work on addition, subtraction, multiplication or division problems on a computer. MathPad is a word processor for math, not a tutorial or calculator. The student provides answers to math problems and the final answers can be checked in the Problem List mode for accuracy.

i hope you find the answer to your question

7 0
2 years ago
Other questions:
  • What is the photosynthesis equation
    13·2 answers
  • What is the advantage of genetic recombination as a mode of reproduction in bacteria
    14·2 answers
  • Number the components below in order from simplest (1) the most complex (7).
    7·1 answer
  • Describe at least two events during meiosis that increase the genetic diversity of the daughter cells produced.
    15·2 answers
  • If water was a non polar molecule how would the properties of water be different
    8·2 answers
  • All these belong to the second line of defense except
    14·1 answer
  • Re
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What are the complimentary strands?
    5·1 answer
  • During which part of the cell cycle does dna replication occur?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!