1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
quester [9]
3 years ago
8

Atoms combine to form what?A. elements b. proton c. molecules ​

Biology
1 answer:
miss Akunina [59]3 years ago
4 0
Atoms combine to form C, molecules !
You might be interested in
What is the name of the enzyme used to make rna nucleotides
Likurg_2 [28]
<h2>RNA Polymerase</h2>

Explanation:

  • RNA polymerase, a chemical in the cell, is  answerable for making mRNA from the  right quality. RNA polymerase is like  DNA polymerase, yet it makes a RNA strand  as opposed to a DNA strand. The promoter region of DNA Helix is attached by  RNA polymerase.
  • It pulls in nucleotides that supplement those  on the DNA strand containing the gene of interest. RNA polymerase duplicates one strand of  DNA to make a stretching bit of singlestranded  mRNA. RNA polymerase makes the  mRNA strand in what is known as the 5' to 3'  course.
8 0
3 years ago
which of the following structures allow materials to be exchanged easily with cells? arteries atria veins capillaries
abruzzese [7]
Atria is a large part of the heart so too big for cells; arteries & veins lead away or to the heart.
Capillaries are the smallest vascular structures that allow materials to be exchanged easily between cells.
7 0
3 years ago
Read 2 more answers
Which part of the electromagnetic spectrum can humans see with the naked eye? Infrared light
aalyn [17]
I am going with x-rays; it is the most visible to the naked eye out of all the choices.
7 0
3 years ago
Read 2 more answers
How do waves interact with different materials?
Flauer [41]

Answer:

Waves interact with matter in several ways. The interactions occur when waves pass from one medium to another. Besides bouncing back like an echo, waves may bend or spread out when they strike a new medium. These three ways that waves may interact with matter are called reflection, refraction, and diffraction.

Explanation:

8 0
3 years ago
Read 2 more answers
13.
Damm [24]
13) B.
14) B.
15) A.
8 0
3 years ago
Other questions:
  • What two organelles are found in plant cells but not in animal cells?
    9·1 answer
  • How can regulations on fertilizer use help keep freshwater life zones clean from pollution?
    8·2 answers
  • Living organisms release energy gradually. why?
    11·1 answer
  • The body of a woman was found in the woods. some hair fibers found on the body were sent to the crime lab for analysis. the ends
    10·1 answer
  • From a population of red brown orange yellow and green butterflies only the red and green ones survive since they can blend into
    12·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Use the drop-down menu to complete the statement. One difference between prokaryotic cells and eukaryotic cells is that a eukary
    6·2 answers
  • Is it possible that after the first meeting of male and female through sexual inter course
    13·1 answer
  • Help please i will give you brain list ​
    12·2 answers
  • What are the 5 major Oceans?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!