1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inna [77]
3 years ago
9

Peyer's patches are mucosa-associated lymph tissue located in the

Biology
2 answers:
Vinil7 [7]3 years ago
7 0

Answer:

The wall of the small intestine

Explanation:

gladu [14]3 years ago
3 0
Peyer's patches are located in the mucosa and extend into the submucosa of the small intestine, especially the ileum.
You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
You are studying a population of snapdragon plants on Membata Island. In snapdragons, the dominant allele CR encodes red flowers
fredd [130]

Answer:

we will know that the allelic frequencies are for R 0.95 and r 0.05

Explanation:

We know that the population is in Hardy-Winberg equilibrium, we deduce the following formula:

p + q = 1

p2 + 2pq + q2 = 1

data

R: red flower allele

r: allele blor blanca

p would be equal to the allelic frequency R

q will be equal to the frequency allelic r

2p = RR

2q = rr

2pq = Rr

If there are 25 white flowers in 1000 plants, their frequency will be:

2pq frequency of the Rr genotype

white flower = 25/10000 = 0.0025 = rr = 2q = 0.0025

we deduce that q is equal to 0.05

we replace the data with the previous formula

p + q = 1

p = 1-0.05

we get as a result

  p = 0.95

if p = 0.95 and q = 0.05

we will know that the allelic frequencies are for R 0.95 and r 0.05

7 0
3 years ago
Read 2 more answers
A species in a changing environment would have the best chance of survival as a result of a mutation that has?
Nuetrik [128]
Hi There! :)

<span>A species in a changing environment would have the best chance of survival as a result of a mutation that has?

</span><span>That species would have it's best chance of survival as a result of a mutation that has a high adaptive value that occurs in its gametes.
</span>           
                                Thanks PrinceBrainly!

5 0
4 years ago
Does prokaryotes consist of chromosomes?
Levart [38]
Well Prokaryotes usually consist of only one chromosone. 
7 0
3 years ago
I need number 5 please
lara31 [8.8K]
ITS TWO WE R LEARNING ABOUT IT RN
4 0
3 years ago
Other questions:
  • Lillette, 9, has been diagnosed with _____, a cancer in which the bone marrow manufactures an abundance of abnormal white blood
    15·1 answer
  • Water in the diet can come from the foods that you eat, as well as liquid foods and beverages. The dietary reference intake for
    5·1 answer
  • How natural selection could lead to a change in allele frequency
    11·2 answers
  • Where do kreb's (step 2) and the etc (step 3) occur?
    11·1 answer
  • Research data that is presented using descriptive language is said to be __________. A. quantitative B. qualitative C. experimen
    10·1 answer
  • What is the diference between the question and hypothesis steps in scientific inquiry? a. The question step provides the questio
    11·1 answer
  • Plzzzz help which of the following are correct about DNA fingerprinting
    6·2 answers
  • 1. What is the study of the cosmos? The study of the cosmos includes what topics?
    12·2 answers
  • What are the parts of the pistil and the stamen? Which is male, which is female?
    6·1 answer
  • Some plant seeds germinate better if scarified in the stomach of a bird or being singed in a forest fire.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!