1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
podryga [215]
3 years ago
11

What is one thing that earthquakes, volcanoes, and tsunamis have in common

Biology
1 answer:
kirza4 [7]3 years ago
8 0
They are natural disasters.
You might be interested in
What does crenate mean
lidiya [134]

Answer:

(especially of a leaf or shell) having a round-toothed or scalloped edge

Explanation:

7 0
3 years ago
Read 2 more answers
The table shows the osmotic potential of a range of sucrose solutions.
Aleksandr [31]

Explanation:

(b) Explain why the plant tissue was left in sucrose solution for 10 minutes before the cells were observed.

5 0
1 year ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Mary has type A blood and her husband (John) has type B blood. John's parents both had type AB. Mary and John havethree children
EleoNora [17]
Because one has rule A so it wouldn't make Sense.
7 0
2 years ago
1. What is sustainable energy? 2. How do we currently use energy in Georgia? 3. Which types of fossil fuels could / should we us
devlian [24]

1. Sustainable energy is the one that meets the needs of the present without compromising the possibility of future generations to meet their own needs for energy. This is actually an effective way of producing energy that has a little harmful effect on the environment. 

There are three conditions that some energy must satisfy in order to belong to the group: 

- ecologically: clean, renewable

- social: available for everyone  

- economic: provides at least the minimum profit

Sustainable energy includes the use of renewable energy sources such as hydropower, wind energy, solar energy, wave energy, geothermal energy, biomass energy.


2. In Georgia, the most of energy consumes transportation and industrial production is the second energy consumer in the country. There are many industrial plants that consume a lot of energy such as food and beverages, tobacco, chemical, plastics, wood, machinery and metal industry. Energy consumption by the population is almost identical to the consumption by industry.



3. We should use less coal and petroleum because they are the largest source of greenhouse gas emissions, like CO2 from fossil fuel combustion. Combustion of fossil fuels also produces other air pollutants, such as nitrogen oxides, sulfur dioxide, volatile organic compounds and heavy metals which damage our environment.


4. We should use more solar energy, wind energy, and geothermal energy. These sources of energy are inexhaustible and free, and the most important characteristic of the resources is that they do not pollute the environment. Also, it is a better choice to build own renewable energy facilities than import costly fuels.


5. In my area, I would propose next renewable energy sources: biomass, wind and solar power. Here, there is a flat land and during the year we have a lot of sunny and windy days. There is huge potential for producing the kinds of energy and it would be economically rentable. Also, it is a forest area with the great amount of biomass, which could collect and use for energy production instead of rotting on the ground.


6. We could do a lot of things to decrease energy consumption, starting from simple things like turning off the lights, using energy efficient light options (LED bulbs), unplugging electronics which use standby power, choosing energy-efficient items, better insulation of houses etc. Also, we could less drive own cars and use more public transport or ride bicycles.

3 0
3 years ago
Other questions:
  • Which scientist conducted tests on extracts made of bacteria to show that the genetic material in bacteria is DNA?
    7·1 answer
  • What is the chemical in leaves that absorbs light?
    6·2 answers
  • What are the major advantages and disadvantages of using coal, oil, and natural gas?
    13·1 answer
  • What is the term that scientists use when comparing the properties of solids liquids and gases
    11·1 answer
  • What life cycle adaptation does the desert gold poppy have that helps it reproduce and survive in its dry desert environment?
    6·1 answer
  • Which of the following is a demonstration of the polarity of water?
    12·1 answer
  • Nora traveled for the first time by air. Just before take-off, she felt nauseated. Now that she has made a few more trips, she d
    10·2 answers
  • Hello My name Is Chloe, Do you think you can help me with My Question
    11·2 answers
  • In a short, detailed paragraph, please answer the following.
    14·1 answer
  • If you run at 12 m/s for 15 s, how far will you go?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!