1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mice21 [21]
3 years ago
15

Seed-bearing plants are also referred to as a. Gymnosperms c. Sporosperms b. Hypnosperms d. Amniosperms

Biology
2 answers:
Sedbober [7]3 years ago
8 0
I believe the answer is Gymnosperms
Lady_Fox [76]3 years ago
7 0
The correct  answer is gymnosperms
You might be interested in
What does this photograph show?
hichkok12 [17]

Answer:

2 or 1 pretty sure its one ur welcome bestie

Explanation:

7 0
3 years ago
The nuclosome is rish in :​
iren [92.7K]

Explanation:

The nucleosome is the fundamental subunit of chromatic.

7 0
3 years ago
During what step of mitosis are two cells formed
horsena [70]
That would be cell division
7 0
3 years ago
Natural bath sponges are the remains of
Rina8888 [55]

Answer:

animal skeletons

6 0
4 years ago
Which organelle is used for transportation?
photoshop1234 [79]
D - the endoplasmic reticulum (ER)
6 0
3 years ago
Other questions:
  • What is an organism’s niche?
    14·2 answers
  • The only antibodies that normally cross the placenta are
    14·1 answer
  • Describe the milankovitch cycle.
    12·1 answer
  • A subpopulation of plant, isolated from the main population, is found to obey the function below, describing the number of indiv
    11·1 answer
  • What is the evalution of managment​
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Please help
    8·1 answer
  • 9. According to Larry Crawford, what is the most difficult part as Growing
    11·1 answer
  • HELP YOU"LL GET BRAINLIST
    15·1 answer
  • What are complications you may see as a result of poor nutrition?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!