1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksi-84 [34.3K]
3 years ago
15

What stage in meiosis does crossing over occur?

Biology
2 answers:
kipiarov [429]3 years ago
7 0
It occurs during The prophase stage
Delicious77 [7]3 years ago
6 0
It occurs during the prophase stage
You might be interested in
What are on the surface of most vertebrate cells, acting as markers of self?
Oliga [24]
It's called major histocompatibility complex protein
4 0
3 years ago
Who are the units of Newtons named
tankabanditka [31]
C french scientists, Sir lsaac newton
7 0
3 years ago
Read 2 more answers
PLEASE HELP ME ASAP. Classify the energy sources as either renewable or nonrenewable. A. energy obtained from coal B. energy obt
DiKsa [7]

The energy that can be renewed again and again is known as renewable source of energy. Example : water, sunlight, wind et cetera.

The energy cannot be created again,once destroyed is known as non renewable source of energy.

The energy obtained from coal is non-renewable.

Energy obtained from burning plant waste is renewable

Energy obtained from water spring inside the earth is renewable.

Energy obtained from natural gas is non renewable.

4 0
3 years ago
Read 2 more answers
Plants showing hydrotropism grow in response to _____.
oksano4ka [1.4K]
Plants showing hydrotropism grow in response to water.
8 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • What is carried to the body cells by blood? (more than one)
    15·2 answers
  • How did john snow use maps to study the spread of cholera?
    7·1 answer
  • Which of these is evidence of global warming ?
    13·2 answers
  • What kind of rock can sandstone be classified as?
    6·2 answers
  • Some peeled pieces of apple were placed in purified water and some in heavily concentrated salt water. The cells in the apple pi
    13·2 answers
  • In an ecosystem, phosphate levels are usually low because:
    9·1 answer
  • To be considered _____, a theory must be supported by multiple sources of evidence.
    5·1 answer
  • Please help me!
    6·2 answers
  • Moving a spring toy up and down will create what kind of wave?
    9·2 answers
  • If these organisms were arranged in energy pyramid, which organism would have the least amount of total available energy in rela
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!