1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
krok68 [10]
3 years ago
10

Molten hot magma that cools very slowly can cause ______________ in igneous rock.

Biology
2 answers:
bogdanovich [222]3 years ago
6 0
Molten hot magma that cools very slowly can cause the formation of large crystals in ingenious rock.
Anna007 [38]3 years ago
3 0
The answer is D I hope this helped
You might be interested in
He is kinetic energy moving from a warmer object to a cooler object.... how is this false??
Anton [14]
Cause kinetic energy does not move until it is activated and if it was a magnet then it would go to it if it was a metal :P

4 0
3 years ago
Read 2 more answers
Which term refers to the stages an organism goes through, from birth to death?
Verdich [7]
The answer is A because in a life cycle it start of in birth, then growing up, then adult then giving birth and then death. after death or birth the life cycle starts all over again. but in actuality when it gives birth that's when the life cycle is restarted. think as it's us humans. we are born. after that we grow up to be a toddler - young kid => teenager => young adult => then women gives birth => new baby is born. when new baby is born then the life cycle is restarted. but the next step after a baby's born the mom and dad get old and then death is the last step.<span />
7 0
3 years ago
Read 2 more answers
What is an octeocyte?
vagabundo [1.1K]
A bone cell, formed when an osteoblast becomes embedded in the matrix it has secreted.
8 0
3 years ago
What is the volume in milliliters of 0.23 kg of pure water
Citrus2011 [14]

230 is your anwser! sorry bad english

5 0
3 years ago
Im having trouble with this
sleet_krkn [62]
The answer is c :))))))
8 0
3 years ago
Other questions:
  • What are the base pairs in DNA and RNA?
    6·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What happens right after transcription ends?
    6·2 answers
  • The state health department notifies a nursery staff nurse of a phenylketonuria (pku) metabolic screening test result of [7 mg/d
    15·1 answer
  • Which is the pancreatic hormone associated with diabetes?
    6·2 answers
  • BRAINLIESTTT ASAP!!!<br><br> Give a detailed description of a dafofill flower.
    8·1 answer
  • Please Help! What change do we get in membrane potential as a result of acetylcholine binding to nicotinic receptors on skeletal
    9·1 answer
  • Isometric training is ideal for immobilized rehab situations, they facilitate recovery and reduce muscle atrophy and strength lo
    9·1 answer
  • Can humans ever directly see a photon​
    11·2 answers
  • Freckles on someone's cheeks would likely be described as:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!