1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andreas93 [3]
4 years ago
12

How does this level of organization,organ relate to cells?

Biology
1 answer:
Doss [256]4 years ago
4 0
Multicellular organisms have various levels of organization within them. Individual cells may perform specific functions and also work together for the good of the entire organism. The cells become dependent on one another. I hope that makes sense
You might be interested in
TOD_Economics 1 what is the Quiz password
svp [43]
What is the answers or is that what it gives you?

5 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
In the early days of life on Earth, plants were exposed to extremely high doses of ultraviolet radiation. Constant UV exposure r
aliina [53]
Evolution Due to environmental factors, It may not look it, but, needles are leaves, they collect solar radiation to produce glucose through the process of photosynthesis, however, needles are, some would say, evolutionary superior to leaves. Needles themselves hold in more water due to their dense wax coating, they are very difficult for insects and other organisms to eat, one because of their structure, and two because of their acidity, they can catch sunlight all year long due to their winter resilience( they don't fall, during the winter), and they have less surface area for wind to catch, which leaves them better protected from wind than most deciduous trees, however the surface area can also pose a larger problem for less surface area means less sunlight interception, therefore more are needed to compete against regular leaves. But.. I Digress... Plant needles are 'PROBABLY' initially the result of evolution of narrow leaves due to climate or environmental factors. 

Sry its so long got carried away! Hope this helps xD
7 0
3 years ago
Read 2 more answers
Over the course of the semester, I have detailed many of the environmental problems that face us today. I have also told you abo
sveta [45]

Answer:

Waste disposal

Why? Contributes to the greenhouse effect and causes pollution

Solution: If you bring your lunch to school, package it in reusable containers instead of disposable ones. Carry food in reusable plastic or cloth bags, and bring drinks in a thermos instead of disposable bottles or cartons.

Solution: Compost leftover food

Hope this helps

5 0
4 years ago
As a car is driven around burning gasoline, what is released into the atmosphere?
madam [21]
Well the car and the flames are emitting carbon dioxide
7 0
4 years ago
Read 2 more answers
Other questions:
  • Clusters of specialized immune cells located throughout the gastrointestinal tract are known as
    14·1 answer
  • True or false our atmosphere is very thin compared to the size of the Earth?​
    15·2 answers
  • The zones of the marine biome are determined by light penetration, distance from shore, and depth. Please select the best answer
    12·1 answer
  • Inherited traits are passed down from our parents to us, their offspring, by the information that is coded in our parents'_____.
    9·2 answers
  • Which factor is NOT a strong piece of evidence for evolution?
    9·1 answer
  • What is gene flow?
    8·1 answer
  • HELPPPPP HELLLLPPPPP ASAPPPPPP
    7·1 answer
  • The microscope best for viewing living cells at low levels of magnification is the
    7·1 answer
  • Do copd sufferers die of respiratory causes or other causes?
    7·1 answer
  • 1. A hypothesis is a guess - like flipping a coin.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!