1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr1967 [171]
4 years ago
6

What is the scientific inquiry

Biology
1 answer:
Nastasia [14]4 years ago
5 0

it is 5 percent ok want to date

You might be interested in
Organisms living in the deep bathypelagic and abyssopelagic zones require oxygen for respiration. What process brings oxygen fro
alekssr [168]

The correct answer is upwelling from equatorial to Polar Regions results in bringing oxygen from the epipelagic zone to deeper oceanic zones.  

It is a process in which the wind mediated motion of nutrient-rich, dense, and cooler water is moved towards the surface substituting the nutrient depleted and warmer surface water. The epipelagic zone refers to the upper layer of the ocean, which is abundant in oxygen and gets the majority of the sunlight for the procedure of photosynthesis. The upwelling of water from the equatorial to the polar region brings oxygen.  


3 0
3 years ago
Extend your thinking: When you think of the word “respiration,” you might think about the process of breathing, which is actuall
Mars2501 [29]

Answer:

When you breathe in, you obtain the cells needed to perform cellular respiration.

Explanation:

4 0
3 years ago
Science can never completely prove or disprove an idea​
LekaFEV [45]

Right it can be ur right good job lol

3 0
4 years ago
Read 2 more answers
You can hold about 25 items in your short-term memory. True or false
kumpel [21]
True u can hold about 25 items in your short term memory
6 0
3 years ago
Explain 2 social benefits of biodiversity
lilavasa [31]

Answer: Biodiversity is important in supporting vital ecosystem services (ES) such as provision of clean water, but can also provide social benefits, such as improved employment. The report focussed on the impact of biodiversity on employment and the value of biodiversity and the services provided for vulnerable rural people.

4 0
4 years ago
Other questions:
  • Which are signs of reproductive maturity?
    14·2 answers
  • 2. In consideration of the following genetic cross: XBXb x XBY Color blindness is a recessive trait (b) and normal vision is dom
    10·1 answer
  • The pie chart depicts land use in the United States as of 2010. What would be a negative environmental consequence of the conver
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • A nucleotide is a phosphate-sugar-nitrogen base <br><br> true or false
    6·2 answers
  • Your team must design an area in your school where students can relax between classes. You need to choose a material for a walkw
    7·2 answers
  • Your teacher takes a candle and cuts some wax from the bottom of it. She puts the bit of wax in a beaker and places it on a hot
    10·1 answer
  • Describe an adaptation to a plant's life cycle and explain how this adaptation helps the plant survive.
    9·1 answer
  • Pretend your classmate has told you that they are having trouble with what succession is. How would you explain to them what suc
    5·1 answer
  • I Really Need Help Please! I Will Mark Brainliest
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!