1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tamaranim1 [39]
4 years ago
9

Which are limiting nutrients for plant growing

Biology
1 answer:
poizon [28]4 years ago
6 0

Answer:

I believe it is : water and nitrogen

Explanation:

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
The cessation of telomerase activity as we age limits the number of times a cell can replicate. current research on telomerases
valina [46]

The cessation of telomerase activity as we age limits the number of times a cell can replicate. current research on telomerases is particularly useful in the fight against cancer. This is because, Cancer cells employ a mechanism that activates telomerases, which leads to uncontrolled cellular division.

The body's stages of life are intimately correlated with telomerase activity. During the development of the embryo, the enzyme is active. High telomerase activity, which allows cells to divide endlessly, is a characteristic of cancer cells. In 85–95 percent of malignancies, telomerase is active (3,4).

Learn more about telomerase activity here: brainly.com/question/1136708

#SPJ4

3 0
2 years ago
SEND HELP ASAP PLEASE IM BEGGING
Pepsi [2]

The correct answers are 1, 2 and 4

4 0
3 years ago
Describe at least four ways in which the cns is protected.
kaheart [24]
What exactly is cns?
4 0
3 years ago
In a living organism, at which stage does segregation of gene pairs takes place?
Westkost [7]
The answer to this question is gamete formation. During meiosis, the DNA is only replicated or copied once even if the cell is divided into four different cells. The formation of gamete segregates the gene pairs among the new cells. 
4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the process of succession?
    7·2 answers
  • What functions do endocytosis and exocytosis carry out for the cell?
    10·2 answers
  • I'm desperate. Please help me with this question
    12·1 answer
  • The metabolic process by which macromolecules are broken down to release stored energy is called _________________. select:
    9·1 answer
  • A geneticist introduces a transgene into yeast cells and isolates five independent cell lines in which the transgene has integra
    6·1 answer
  • charlotte just finished her second year in college. She is going to get a job in the Energy career cluster. She would be qualifi
    11·2 answers
  • If an object has a mass of 10 kg on Earth, what would be its mass on a planet with half the gravity of Earth?
    5·2 answers
  • What nitrogenous base is found in RNA
    8·1 answer
  • Describe the role of lignin in plants.
    10·2 answers
  • Click and drag the following structures in the correct sequence to indicate their respective positions in the blood pathway with
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!