Answer:
Option B.
Explanation:
As any reaction of combustion, the O₂ is a reactant and the products are CO₂ and H₂O. Combustion reaction for ethane is:
2C₂H₆ + 7O₂ → 4CO₂ + 6H₂O
So 2 moles of ethane react with 7 moles of oxygen to make 4 moles of dioxide and 6 moles of water.
Then 2 moles of ethane will produce 4 moles of CO₂
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
1.01 x 10^24 molecules.
Explanation:
To calculate the number of molecules in a given number of mole, we can simply multiply by Avogadro's number which is equal to 6.022 x 10 ^23.
Therefore,
10 molecules = 1.68 mol x (6.022 x 10^23 molecules) / (1 mol = 1.01 x 10^24) molecules.
I hope this helps :)
Answer: Alpha
Explanation:
Alpha particle form of decay produces a nucleus similar to the element helium. During Alpha decay an atom spits out two protons and two neutrons from its nucleus.
The property is its polarity (or hydrogen bonds)
