<span>TESTING HYPOTHESIS ABOUT INDIVIDUAL REGRESSION COEFFICIENTS: t STATISTIC) : The t statistic. Used to determine which of the independent variables influences the dependent variable. Whether a particular independent variable influences the dependent variable Test whether the true value of the parameter estimate is zero. The higher the value of the t-statistic, the smaller the value of the regression coefficient is zero.</span>
The correct answer is C, Francesco Redi, who in 1668 demonstrated that life originates from life and there is not the spontaneous generation of life from non-living things like meat. It was the first real experiment which disproved the theory of spontaneous generation.
Answer:
The two blue budgies are most likely to be yyBb each
Explanation:
there are 3 different scenarios possible for crossing blue budgies:
1) yyBB crossed with yyBB
this is not possible because it does not allow for the genotype yybb (white budgies)
2) yyBB crossed with yyBb
again, this cross will not yield the genotype yybb required for white budgies as given in the problem statement
3) yyBb crossed with yyBb
which leaves us with this option being most likely the genotype of the parent budgies who will have white budgies as offspring
Hope that answers the question, have a great day!
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
