1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
V125BC [204]
2 years ago
5

Mitosis _____.

Biology
2 answers:
tensa zangetsu [6.8K]2 years ago
7 0
Mitosis creates two identical daughter cells from one parent cell
statuscvo [17]2 years ago
7 0

Answer:

The correct answer is option A: create two identical daughter cells from one parent cell.

Explanation:

Hello!

Let's solve this!

Mitosis is a type of cell division for eukaryotic organisms. This cell division consists in the fact that from two stem cells originate two daughter cells identical to the mother.

The process ends in that the daughter cells, in addition to being identical to the mother, also have the same number of chromosomes.

We will conclude that the correct answer is option A: create two identical daughter cells from one parent cell.

You might be interested in
Write down chronological order stages of regeneration of a nerve fiber.
Korvikt [17]
The answer is Regeneration of Neural Tissues

Axon regeneration has three phases: sprouting, elongation, and maturation (McQuarrie, 1983). As Schwann cells dedifferentiate and proliferate, the proximal stumps of the axons sprout by the actin-driven formation of growth cones (Sinicropi and McIlwain, 1987).
3 0
2 years ago
An 85-year-old woman is administered a general anesthetic for repair of a hip fracture. Which of the following properties of the
fenix001 [56]

Answer: Solubility in lipids

Explanation:

All the volatile anaesthetic agents has dose dependent respiratory depression VT and MV which may be compensated by increased respiratory rate.

The respiratory depression is more common in case of older people as they cannot compensate for the volume of air.

The solubility of the anesthesia in the lipids can be a risk which can put 85 year old women into respiratory depression.

7 0
3 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
2 years ago
The vegetables, fruits, and cereals that people eat all come from-
34kurt

Answer:

Angiosperms

Explanation:

It states "The flowering plants have a number of uses as food, specifically as grains, sugars, vegetables, fruits, oils, nuts, and spices"

Which is mostly what the question is asking.

Also the other answer choices do not state that they provide vegetables, fruits and cereals as Angiosperms do.

4 0
3 years ago
_______ is the absence of knowledge of the outcome of an event before it happens.
Andrej [43]
The answer is  B) diversification
5 0
3 years ago
Read 2 more answers
Other questions:
  • In which part of the plant is responcible for absorbing water and nutriens?
    7·1 answer
  • Jams, jellies, preserves, honey, and other foods with high sugar content hardly ever become contaminated by bacteria, even when
    6·2 answers
  • This is an organism or cell with two sets of chromosomes.
    9·2 answers
  • explain how complete dominance, co dominance, incomplete dominance, and sex linked traits are inherited and expressed differentl
    9·1 answer
  • What travels through a food chain or web ?
    8·1 answer
  • Which molecule is correctly paired with the class of molecule to<br> which it belongs?
    7·1 answer
  • A __________ is a tool that uses the genotypes of the parents to predict the probability of the possible phenotypes of their off
    14·2 answers
  • How did the moon fom?
    11·1 answer
  • Kinetic energy is a function of
    8·1 answer
  • Explain the role played by muscle and bone when Ahmed picks up a heavy weight from the ground to the table top. 1909299393200202
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!