The answer is Regeneration of Neural Tissues
Axon regeneration has three phases: sprouting, elongation, and maturation (McQuarrie, 1983). As Schwann cells dedifferentiate and proliferate, the proximal stumps of the axons sprout by the actin-driven formation of growth cones (Sinicropi and McIlwain, 1987).
Answer: Solubility in lipids
Explanation:
All the volatile anaesthetic agents has dose dependent respiratory depression VT and MV which may be compensated by increased respiratory rate.
The respiratory depression is more common in case of older people as they cannot compensate for the volume of air.
The solubility of the anesthesia in the lipids can be a risk which can put 85 year old women into respiratory depression.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:
Angiosperms
Explanation:
It states "The flowering plants have a number of uses as food, specifically as grains, sugars, vegetables, fruits, oils, nuts, and spices"
Which is mostly what the question is asking.
Also the other answer choices do not state that they provide vegetables, fruits and cereals as Angiosperms do.
The answer is B) diversification