1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikitadnepr [17]
3 years ago
5

Name: Sasha Evans

Health
2 answers:
xenn [34]3 years ago
6 0
They are different because you will be going at a different ‘speed’ or you may be more active , less stressed?
Law Incorporation [45]3 years ago
5 0
The heart rate is different while dancing, studying and riding a bike because the amount of blood needed for each activity is different. Blood pumps as fast as it as needed by the cells, which is why riding a bike has fast heart rate while studying has a regular heart rate.
You might be interested in
WILL GIVE BRAINLIEST
mote1985 [20]

C is your answer!! Mark brainliest please ❤️❤️❤️

7 0
4 years ago
Going on a high-protein, low-carbohydrate diet can be harmful because it
lisov135 [29]
Because carbs are used for energy
4 0
4 years ago
Read 2 more answers
Discuss 5 important steps relating to career decision making
nata0808 [166]

Answer:

The Five Steps of a Good Career Decision

Step 1 – Understand your Stuckness.

Step 2 – Identify your Decision Criteria.

Step 3 – Identify your Options.

Step 4 – Make a Decision.

Step 5 – Make a Plan and Get into Action.

5 0
3 years ago
Which stage of tumor would most likely present the best prognosis?
MakcuM [25]
Stage 1 tumor would most likely present the best prognosis
5 0
3 years ago
What does muscular strength measure?
LuckyWell [14K]

Answer: B the amount of force that a muscle or muscle group can exert in a single effort

8 0
2 years ago
Other questions:
  • Steve is always cautious before discussing matters openly with his father, Gary. Whenever Steve wants to discuss an important ma
    15·1 answer
  • What is the role of plaque formation in the arteries during heart disease development?
    14·1 answer
  • What medical procedure is associated with the cupping vessels found by archaeologists?
    10·1 answer
  • What is it like to live with anorexia
    10·2 answers
  • Why do mountaineers need to take high-calorie food with them when they climb mountains? ​
    15·1 answer
  • Some health agencies support this while others do not. Do you think this is a wise approach to addressing the obesity in childre
    6·1 answer
  • An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
    12·1 answer
  • A student took these notes in class:
    7·2 answers
  • 22)a nurse provides medication Instructions to a client who is taking levothyrox
    14·1 answer
  • Pov:: You are going for a walk and randomly a person wearing a suit runs up to you and says this ¨We´ve been trying to contact y
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!