1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisabon 2012 [21]
3 years ago
15

URGENT 16PTS!!!

Biology
1 answer:
Andrei [34K]3 years ago
8 0
Transcription<span>. </span>Transcription<span> is the </span>process<span> by which</span>DNA<span> is copied (</span>transcribed<span>) to </span>mRNA<span>, which carries the information needed for protein synthesis. </span>Transcription<span>takes place </span>in<span> two broad steps. First, pre-messenger RNA is </span>formed<span>, with the involvement of RNA polymerase enzymes.</span>
You might be interested in
Witch of the following is also known as the hydrologic cycle?
olga2289 [7]

Answer:

A. Water cycle

Explanation:

The clue is in the name : hydrologic. Hydro- is the prefix for water: think hydroponics, hydrogen, hydro flask :)

3 0
3 years ago
Read 2 more answers
Where will ATPase be found in the mitochondrion? A. in the matrix B. in the inner membrane C. in the outer membrane D. in the in
ASHA 777 [7]
Im not sure i know its in the membrane, i would have to go with B but i could be wrong 
5 0
3 years ago
Read 2 more answers
Is the highness or loudest of a sound
Andrew [12]

I think it is pitch I am not 100% sure

8 0
3 years ago
Choose the scientific question. A. Would you like to have a frog as a pet? B. Who is the smartest biologist alive today? C. Whic
TiliK225 [7]

Answer:

<em>The correct option is D)  How is the number of frogs in Massachusetts affected by pollution</em>

Explanation:

A scientific question can be described as a question which can be answered through the scientific method of research. Based on the scientific question, a hypothesis can be formulated. For example, for the option D, the hypothesis can be 'if the pollution increases, then the number of frogs decreases.' A hypothesis is a tentative statement which can be tested through experiments. Based on these experiments, results are formulated and conclusions are drawn. The question mentioned in option D can be answered through this method hence, it is the correct option.

7 0
3 years ago
If sea floor spreading is happening why isn’t earth getting bigger
Natalija [7]

because the tectonic plats basically folds under at another point

4 0
3 years ago
Other questions:
  • Anyone can help me ^
    6·2 answers
  • Other than their respective systems, what other system could the lungs and skin be classified as members of? Why this system?
    9·1 answer
  • Why would engulfing these smaller prokaryotic cells be an advantage to the larger prokaryotic cells?
    15·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • A condition in which one gene pair masks the expression of a nonallelic gene pair is called ________.
    9·1 answer
  • What is formed when atoms of elements combine?
    12·2 answers
  • In January, a small number of Eastern Cottontail Rabbits were introduced into Red Forest. The population curve of the rabbits is
    10·2 answers
  • Which is a correct interpretation of the cladogram shown below?
    14·2 answers
  • Answer to this question
    15·1 answer
  • The connective tissue that surrounds and separates individual skeletal muscle fibers (cells) is called:_________
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!