1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ozzi
3 years ago
8

Which of the following statements is true during a solar eclipse?

Chemistry
1 answer:
Lady_Fox [76]3 years ago
7 0

Answer:

The sun's light is blocked by the moon.

Explanation:

During the eclipse, the moon rotates right in front of the sun, that's why the eclipse is so rare and only happens every four(?) years/

You might be interested in
Write a net ionic equation to show that acetylsalicylic acid (aspirin), hc9h7o4, behaves as a brønsted-lowry acid in water.
Thepotemich [5.8K]
By definition, Bronsted-Lowry acid is a proton donor in the acid-base neutralization reaction. When a weak acid like acetylsalicylic acid is reacted with water, the water here acts as the Bronsted-Lowry base. This is possible because water has properties of amphoterism - can act as an acid or base. In this case, acetylsalicylic acid would have to donate its H+ atom to water, so that it would yield a hydronium ion, H₃O⁺. The complete net ionic reaction is shown in the picture.

So, in the reaction, the products yield are the acetylsalicylate ion and the hydronium ion.

3 0
3 years ago
SCIENCE HELP !!!! 10 POINTS
stich3 [128]
Im working on science too!! I would help you but the attachment isn't pulling up..
5 0
3 years ago
What are the oxidation numbers of K, Cl, and O in KClO,?
Tatiana [17]

Answer: Oxidation number of chlorine in potassium chlorate...

so, oxidation state of chlorine in potassium chlorate is +1. and yea!!

Explanation: hope this help

4 0
3 years ago
What is a solution?
Keith_Richards [23]

Answer:

A !!

it a mix where everything is combined together

5 0
2 years ago
Read 2 more answers
Is Pb(NO3)2 soluble or insoluble?
Sedaia [141]

Answer: it is soluble

Explanation: nitrates are soluble.

4 0
4 years ago
Other questions:
  • A sample of NaNo3 weighing 0.38g is placed in 50.0mL volumetric flask.The flask is then filled with water to the mark on the nec
    9·1 answer
  • I NEED HELP FAST!!!!! Can you tell me about examples of physical and chemical compounds of matter??? I have a DBA in a few minut
    15·1 answer
  • PLEASE HELP ME!!!!!!!!!!!!
    5·1 answer
  • HELP MEEEE!!!!!!!!!!!
    8·1 answer
  • Write down the formula for B<br> example:<br> Hydrogen + Fluorine = Hydrogen Fluorine <br><br> help
    13·2 answers
  • PLEASE HELP!!!
    10·1 answer
  • Hey! If someone could help me out I would really appreciate it even if it was just one answer. I'm really stuck on 3. Its second
    6·1 answer
  • How many grams of NaNO3 can be dissolved in 200mL of water at 40 degrees Celsius?
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • The system containing all the muscles of the body especially those involved in movement CONSIST of the three types of muscle ske
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!