1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djverab [1.8K]
3 years ago
13

You fall down and scrape your hand – describe what each component of blood would be doing at the injury site.

Biology
1 answer:
fredd [130]3 years ago
4 0
They would be conecting at the site of the injury.
You might be interested in
Which of the following is a compound?<br><br> A. Cl2<br> B. H2O<br> C. He<br> D. H2
ludmilkaskok [199]

B is the compound because a compound is two or more different atoms that combine.

3 0
3 years ago
Need answer please fast<br> Amplitude<br> Crest<br> Trough<br> Wavelength
Lina20 [59]
The red line is the wavelength
The blue line is the amplitude
5 0
3 years ago
Based on our consumption of fossil fuels today, what can be predicted?
pishuonlain [190]
I think the top three statements are the answer.
5 0
3 years ago
1500-<br> NA<br> 4) What directions is Star Creek flowing? How do you know?
Svet_ta [14]

Answer:

Star Creek is flowing from East to West, that is because the creek is small and has just begun to form as an extension of the Cayuta Creek.

Explanation:

4 0
2 years ago
4. What type of cells are haploid?
USPshnik [31]

Answer:

A haploid is a cell with a single set of chromosomes.

7 0
3 years ago
Read 2 more answers
Other questions:
  • What happens to ordinary plants (not C 4 or CAM) when stomata close?
    15·2 answers
  • How can loss of biodiversity affect human health?
    8·2 answers
  • 10.LID)..
    6·1 answer
  • Please do 2,3, and 4
    8·1 answer
  • 4. From what structures do the spindles originate?
    7·1 answer
  • PLEASE HELP!!!!!!!!!!
    9·1 answer
  • Can parents with A and B blood type have a baby of O <br>if yes please state reason ​
    13·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Solar power plants that use a central receiver system or a distributed receiver
    6·1 answer
  • Remnants of osteons, which have been almost completely recycled by osteoclasts, are known as __________
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!