1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergeeva-Olga [200]
3 years ago
9

Which is not considered part of the cytoplasm?

Biology
1 answer:
Gnoma [55]3 years ago
8 0
You did not provide options therefor i can not be exact but the cell membrane and cell walls are what contain the cytoplazm so it would not be ar
 part of it
You might be interested in
Sperm is produced in the?
Alenkasestr [34]

Answer:

testis

Explanation:

produced from the testicals

3 0
3 years ago
Read 2 more answers
Which of the following is a direct result of deforestation? (4 points)
prohojiy [21]

The direct result of deforestation is habitat loss.

<h3>What is deforestation?</h3>

Deforestation is defined as the purposeful felling of trees which are used for domestic use and the space created is used for agricultural purposes

The direct impact of deforestation is the effect it has on the arboreal habitat. The animals that live on trees have their habitats destroyed.

Learn more about deforestation here:

brainly.com/question/579463

#SPJ1

3 0
2 years ago
Could anyone please help me answer this?? Thanks.
solniwko [45]

Answer:

Insects, Arthropoda and vertebrates

Explanation:

7 0
3 years ago
Read 2 more answers
The eye, heart in skin of a pig, and a leaf from an oak tree are all examples of_______. They are groups of tissues join togeth
Mazyrski [523]

Answer:

it should be organ .....

8 0
3 years ago
Which of the following statements is FALSE?
Aliun [14]

Answer:

C

Explanation:

4 0
3 years ago
Other questions:
  • Which statement best describes Earth’s outer layer underneath the surface in the image?
    11·1 answer
  • What is the correct way that the scientific name for the american black bear should appear in print?
    7·1 answer
  • There is a mutation in the rate limiting enzyme which prevents it from binding its substrate. How will this mutation affect the
    6·1 answer
  • The entire complex that forms to initiate DNA replication is known as:_______
    9·1 answer
  • An energy pyramid is a graphical model of energy flow in a community. The different levels represent different groups of organis
    8·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is "twinkling"? (in telescopes) a. Flashing of quickly revolving starts b. Distortion of light in the very large mirrors of
    6·1 answer
  • Sara just found out that her sister conceived about seven days ago. She rushes to find a book on pregnancy so that she can learn
    14·1 answer
  • Which of the following is an abiotic factor you might find in a desert
    10·2 answers
  • at which stage in kohlbergs level of conventional morality does an individual realize the importance of maintaining law and orde
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!