1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ira [324]
3 years ago
12

How does the design of your experiment control for outside factors that may affect the results?

Biology
2 answers:
Valentin [98]3 years ago
7 0

Answer:

A factor of an experiment is a controlled independent variable; a variable whose levels are set by the experimenter. A factor is a general type or category of treatments. Different treatments constitute different levels of a factor

An experiment has several types of variables, including a control variable (sometimes called a controlled variable). ... A control variable is another factor in an experiment; it must be held constant. In the plant growth experiment, this may be factors like water and fertilizer levels.

Explanation:

nevsk [136]3 years ago
3 0

Answer:Here is one possible answer:

The seeds will all be planted at the same time and provided with the same amount of light and water. Three trials of the experiment will be conducted to improve the accuracy of the results.

Explanation:

You might be interested in
Comprehend and summarize the process of photosynthesis, such as the roles of light, carbon dioxide, water and chlorophyll; produ
ira [324]

Answer:

the chemical equation for photosynthesis is 6CO2 + 6H2O → C6H12O6 + 6O2

Explanation:

reactents-Photosynthesis requires sunlight, carbon dioxide, and water as starting reactants (Figure 5.5). After the process is complete, photosynthesis releases oxygen and produces carbohydrate molecules, most commonly glucose. These sugar molecules contain the energy that living things need to survive.

stomata- underside of leaf

02(oxygen)-releases oxygen for any living thing

sun is necessary

xylem is a series of tubes

chloraphull must be present

4 0
3 years ago
I attached the question ​
irinina [24]

Answer:

ciliated salivary gland eputhelium

8 0
2 years ago
Large molecule made up of amino acids
german

Answer:

Protein

Explanation:

Proteins are composed of amino acids

8 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
What is a difference between prokaryotic and eukaryotic cells? A. Prokaryotic cells do not have a nucleus, but eukaryotic cells
svet-max [94.6K]

Answer:

The correct answer is A

Explanation:

Eukaryotic cells have a nucleus containing their DNA, whereas prokaryotic cells do not have a nucleus.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Plants release water into the atmosphere process called----
    5·1 answer
  • What type of connective tissue is found only in the umbilical cord?
    12·1 answer
  • What are common features of El Niño and La Niña
    5·1 answer
  • Anybody can help me out?
    14·1 answer
  • The Theory of spontaneous generation was A theory that was supported over time by new facts and data. A theory that was never te
    11·2 answers
  • The gradual change in an ecosystem in response to environmental change is called succession. From what you have learned, how is
    15·2 answers
  • A lunar eclipse can occur during a full moon .
    11·2 answers
  • Help please ! Thanks
    12·2 answers
  • Hydrocarbons are not very soluble in water because
    6·1 answer
  • When the cell is not in the presence of tryptophan,
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!