1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivann1987 [24]
3 years ago
12

Which of the following describes the structure formed when a probe

Biology
1 answer:
miv72 [106K]3 years ago
7 0
It’s D a single stranded structure consisting of unlabeled DNA from the gene
You might be interested in
Find the missing link:
yulyashka [42]

Answer:

biotic

Explanation:

3 0
2 years ago
Read 2 more answers
40 POINTS
bagirrra123 [75]

Answer:

D. Osmosis

Explanation: a process by which molecules of a solvent tend to pass through a semipermeable membrane from a less concentrated solution into a more concentrated one, thus equalizing the concentrations on each side of the membrane.

3 0
3 years ago
11. Who suggested that peppered moths were an example of natural selection?
weeeeeb [17]

Answer:

J. W. Tutt suggested that peppered moths were an example of natural selection.

Explanation: Before industrial revolution, the population of white peppered moth is high as compared to dark peppered moth because white peppered moth can't be seen at night by the birds. After industrial revolution, sooth is spread on the surface of the trees which make easy for the bird to see white peppered moth and feeds on them. Population of white peppered moth decreases while the population of dark peppered moth increased because they cannot be seen in the dark due to black color of sooth.

3 0
3 years ago
By what mechanism would a nonpolar molecule move across a membrane if it is moving up its concentration gradient
SVEN [57.7K]
Non polar molecule move across a membrane through simple diffusion, when moving up their concentration gradient. Simple diffusion involves movement of molecules through a membrane without the help of integral membrane protein. These molecules are driven by the force of diffusion. This is different from facilitated diffusion where molecules only move with the aid of integral protein in the membrane. 
8 0
3 years ago
What are two adaptations that enable mammals to survive cold winters
natka813 [3]
The answer is <span>Hibernation and thick fu</span>r, i used my prior knowledge to ANswer this Question
4 0
3 years ago
Other questions:
  • Diamonds are often used in rings and other jewelry. This is an example of a mineral being used for ? purposes
    10·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Ugh yuck biology .....help if you can .-.
    10·1 answer
  • What role do memory cells play in immunity
    9·2 answers
  • Wilms tumor is a tumor of childhood. it is usually an encapsulated mass occurring in any part of the kidney. what are the common
    12·2 answers
  • Which of the following explains what is happening to the fish population due to the increase in human population?
    10·1 answer
  • What is the best definition of a eukaryotic cell?
    13·2 answers
  • Two populations of a species of flightless bird became separated by a river and the birds became two different species. How woul
    8·1 answer
  • Plz help
    15·2 answers
  • Which of the following statements is a principle of the cell theory that supports the idea that new cell will replace damaged ce
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!