1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivanshal [37]
3 years ago
14

What happens to the force of gravity between two objects as they move farther away from each other?

Biology
1 answer:
andriy [413]3 years ago
3 0

The gravity they have stays the same all the time unless their mass decreases, but they have less gravitational force on each other as they move apart.

You might be interested in
Which of the following denotes the divisions of the geologic time scale in correct order of decreasing lengths of time beginning
Stels [109]

Answer:

d. eon, era, period, epoch

Explanation:

The geological time scale has been made so that the scientists can have a practical system about the classification of geological time, thus everything that has happened throughout it. The geological time unites have been defined in accordance with important events that have happened, thus marking their end or beginning. These events can be mass extinctions, catastrophes, climate patterns, domination of certain species etc. The longest of these time units is the eon, lasting for more than half a billion years, and up to 2 billion years. The era comes as the second longest time unit, lasting for several hundred million years. The period lasts for several tens of million years, and the epoch is the smallest unit, lasting for few million years, or several hundred thousand years.

3 0
3 years ago
Which organisms are most critical in the nitrogen cycle?
Strike441 [17]
These are the things that convert nitrogen in the soil -cyanobacteria<span>participate. After nitrogen has been fixed, other </span>bacteria<span> convert it into </span>nitrate<span>, in a process known as nitrification.</span>
8 0
3 years ago
What role do decomposers play in the movement of matter<br> through an ecosystem?
GaryK [48]

Answer:

Decomposers play a critical role in the flow of energy through an ecosystem. They break apart dead organisms into simpler inorganic materials, making nutrients available to primary producers

Explanation:

4 0
2 years ago
Read 2 more answers
The diagram illustrates the differences between the skulls and brain volumes of three extinct hominins. Rank the species shown i
vfiekz [6]
Its B. <span>Australopithecus africanus, Homo erectus, Homo neanderthalensis</span>
7 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • What are the two main functions of the nervous<br>system?​
    6·2 answers
  • The defecation reflex __________. involves long and short reflexes and involves two positive feedback loops involves two positiv
    5·1 answer
  • ________________ and water, in the presence of light energy, are the reactants in photosynthesis. A) Oxygen B) Carbon Dioxide C)
    6·2 answers
  • The niche of a species is the functional role of that species in the community that it belongs to. Species that have narrow nich
    15·1 answer
  • Early observations of a cultured cell line indicated that the cells did not exhibit either density-dependent inhibition or ancho
    13·1 answer
  • A particular plant has 10 pairs of chromosomes in each cell. For each of the plant's gametes, how many genetic combinations are
    6·2 answers
  • NEEDED NOW PLZ!!!
    12·1 answer
  • HELP ME WITH THIS 60 POINTS,5-STAR RATING, AN THANKS AND MARKED AS BRANLIEST.
    5·1 answer
  • Differentiate between "lock-&amp;-key" and "induced fit"
    13·1 answer
  • This is a star that is generating light and heat by the conversion of hydrogen to helium by nuclear fusion in its core.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!