Answer:
DNA carries the genetic information for making proteins. ... The base sequence determines amino acid sequence in protein. Messenger RNA (mRNA) is a molecule which carries a copy of the code from the DNA, in the nucleus, to a ribosome, where the protein is assembled from amino acids.
Explanation:
(meow) <3
Answer:
because the body requires a higher supply of oxygen
Explanation:
Cellular respiration can be divided into two different metabolic processes: aerobic respiration which needs oxygen (O2) and anaerobic respiration (without O2). The aerobic cellular respiration is produced when glucose molecules react with O2 in order to form ATP, the energy currency of the cell. Aerobic cellular respiration is the main source for generating ATP. During exercise, the requirement of O2 will be higher because the cellular respiration rate is increased in order to produce more energy (ATP). In consequence, during physical activities, it is required have to breathe faster to supply this O2, which enters into the lungs to be transported to all the cells through blood circulation.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
All cells have a plasma membrane, ribosomes, cytoplasm, and DNA. The plasma membrane, or cell membrane, is the phospholipid layer that surrounds the cell and protects it from the outside environment. Ribosomes are the non-membrane bound organelles where proteins are made, a process called protein synthesis.
Answer:
D
Explanation:
The changes in eating noted in the first study are due to fibers that are passing through the lateral hypothalamus. The lateral hypothalamus is a region of the brain with a key function of coordinating an array of cognitive and physical processes such as feeding
