1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rina8888 [55]
4 years ago
11

A mother brings a 15-month-old child to the well-baby clinic. she states the child has been taking approximately 18 to 20 oz (54

0 to 600 ml) of whole milk per day from a bottle with meals and at bedtime. the nurse should suggest that she begin weaning the child from the bottle to avoid risking:
Biology
1 answer:
svet-max [94.6K]4 years ago
3 0
A 15-month-old child, equivalent to a child of 1 year and 3 months of age, should have began weaning from bottle feeding from 6 months of age. Tooth decay or dental caries are commonly associated with prolonged bottle feeding as the sugars and other substances in milk; when drank from a teat from a bottle; prolongs the exposure of teeth to the milk, leading to overgrowth of bacteria causing dental caries. 
You might be interested in
All organisms must compete for survival true or false
Lisa [10]

Answer:

False

Explanation:

fjfuffugigifififfjfuf

5 0
3 years ago
A sequence of three nitrogenous bases in a messenger-rna molecule is known as a.
sergejj [24]

Answer:

A sequence of three nitrogenous bases in a messenger-rna molecule is known as <em><u>Codon</u></em>

Explanation:

Codon is a triplet of three nitrogenous bases present in mRNA. It can be any three from uracil, adenine, guanine or cytosine. They are arranged in specific order and code for specific amino acids.

5 0
2 years ago
household bleach has ph between 12 and 13. From. this information, which of the following best describes the bleach solution
andrew-mc [135]

Answer:

It would be a BASIC substance

Explanation:

Basic is the opposite of acidic

4 0
3 years ago
Proteins made on ribosomes may be further modified within which organelle?
madreJ [45]
D. golgi complex because it receives proteins and lipids from the ER , and packages and diatribes theses substances throughout the cell.
8 0
3 years ago
The _____ is the process that describes the formation, breakdown, and reformation of Earth's rock and mineral materials.
salantis [7]
The answer is C(rock cycle)
5 0
3 years ago
Other questions:
  • Do Bacteriophages engulf and destroy viruses.
    14·1 answer
  • What is laws and thoerys
    6·2 answers
  • Juanita and Alfred hypothesize that a seed will sprout faster if it is warmer. They plant three seeds and water them the same am
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Explain why a triple bond between two nitrogen atoms is stronger than a double bond between two oxygen atoms
    11·1 answer
  • Describe how the digestive system breaks down food
    11·2 answers
  • Prokaryotes stain as Gram-positive or Gram-negative because of differences in the cell _______.
    8·1 answer
  • A mosquito cell in G1 of interphase has six chromosomes. How many sister chromatids does the cell have during metaphase?
    8·1 answer
  • _____________ are present in an organism, but they don't function in the same way they used to. HELP ILL GIVE BRAINLIEST!!! pict
    12·1 answer
  • What can you conclude about an average star's brightness and temperature?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!