1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olenka [21]
4 years ago
8

Investigate the evidence that molecular clocks provide for evolutionary descent.

Biology
1 answer:
Diano4ka-milaya [45]4 years ago
3 0
A molecular clock is a method used by researchers that uses mutation rates in DNA to estimate the length of time that two species have been evolving independently. This provides evidence of evolutionary descent because it can link to common ancestors.
You might be interested in
The frequency of a vibrating object is defined as what
WINSTONCH [101]

Answer:

Una vibración se puede caracterizar por su frecuencia y su intensidad. La frecuencia es el número de veces que se completa un ciclo de oscilación y se mide en hercios (Hz). Un hercio equivale a un ciclo por segundo.

Explanation:

8 0
3 years ago
Read 2 more answers
A group member can attain social dominance by
goldenfox [79]
Social dominance is the social status characterized with dominance. The dominance is a characteristic of highly social animals, such as humans. Individuals of the same species compete with one another for food, mates, territory, or any other resource, including money. They establish social relationship with each other and an individual can attain social dominance by engaging in social competition. (D). The outcome of the competitions is: the dominant individual gets what he wants and the subordinate doesn't.
5 0
3 years ago
A researcher finds that white bread contains more preservatives and has a higher moisture content than wheat bread. She designs
velikii [3]

Answer: She will need to learn out how to quantitatively measure mold growth to measure the dependent variable.- last choices

5 0
3 years ago
Read 2 more answers
The path urine takes after it is formed until it leaves the body is the urethra, urinary bladder, and finally the ureter.
Nikitich [7]
I think it is urinary bladder which take all process
6 0
3 years ago
The diagram shows a nerve cell. Which row in the table labels the diagram correctly?
Snowcat [4.5K]

<u>Answer</u>:

The row C shows the correct labelling .

<u>Explanation</u>:

  • <em>Neurons</em> are the cells of the nervous system that transmit and receive nerve impulses.
  • The basic structure of a neuron consists of the <em>cell body, the axon, and the dendrites. </em>
  • The<em> cell body</em> consists of the nucleus and thus contains the genetic material of the neurons. Emerging out from this are 2 types of extensions - dendrites and axon.
  • The <em>dendrites</em> are involved in receiving messages from the other neurons whereas the <em>axon</em> is responsible for conducting the electrical impulses away from the cell body.
3 0
3 years ago
Read 2 more answers
Other questions:
  • What process occurs as the zygote travels towards the uterus in the fallopian tubes?
    12·1 answer
  • Why do you think the eukaryotic DNA requires multiple origins of replication?
    11·1 answer
  • Which of the following is not a part of Darwin’s theory of evolution
    5·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • The temperature 23 F is equivalent to __ C?
    7·1 answer
  • Choose the plant that grows from a stem. cattails onions grass beans
    5·1 answer
  • I need help on these questions, I don't understand.<br><br>A=<br>B=<br>C= <br>D=<br>E=
    15·2 answers
  • How does the structure of the skull help prevent injury to the brain?
    15·2 answers
  • I really need help on the evolution quiz ​
    11·1 answer
  • The Hydrogen Ion concentration gradient is what fuels ATP synthase and ATP production? True or False
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!