1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pogonyaev
3 years ago
10

How can astronomers tell what a distant object's velocity is?

Biology
1 answer:
IgorLugansk [536]3 years ago
3 0
A.) By measuring the redshift or blueshift , which is actually nothing but spectral lines on electronmagnetic spectrum of that
You might be interested in
True or False? : A good scientific experiment will only test one variable. Everything else will be kept constant.
liubo4ka [24]
True! because if you have more than one variable, you aren’t going to know which variable changed the dependent variable.
4 0
3 years ago
Read 2 more answers
For average organism, heavy digestion (overnight with an excess of enzyme) of chromatin with micrococcal nuclease would yield a
ASHA 777 [7]

Answer:

150 - 300 bp

Explanation:

Micrococcal nuclease, indistinctly from the time of treatment and in average organisms, will realize the cuts on DNA o RNA zones rich in AT or AU. It is not a specific endonuclease.

Even so, the mean size of the expected fragments will have between 150 bp and 300 bp.

It is very important to run your digestion along with a proper label.

5 0
3 years ago
Select the correct answer from each drop-down menu.
aksik [14]

Answer:

Just before the cat drops, it was stationery. Therefore it has energy of position called  potential energy.As it drops, the Gravitational potential energy is converted to Kinetic Energy,The conversion mid- air is P.E to K.E to P.E to K.E to P.E to K.E, until it touches the ground. As it touches the  ground all the energy is converted to P.E energy of position.

As it runs after mouse the P.E is converted back to Kinetic , energy of motion. As it feeds on the mouse , the chemical energy obtained  as protein from mouse meat.This is later converted back to Mechanical energy as (kinetic and Potential  energy)   in the cat.

Explanation:

4 0
3 years ago
Read 2 more answers
When a sucrose molecule is digested which monosaccharide are produced
Artemon [7]
The monosaccharides that are produced when sucrose is digested would be glucose and fructose.
6 0
3 years ago
A disadvantage of sexual reproduction is that
atroni [7]
C. since sexual reproduction takes a lot longer and it involves 2 offsprings. it requires more energy
5 0
3 years ago
Other questions:
  • What’s the phenotype of the parent cat
    13·1 answer
  • Which taxonomic group is a group of similar families?
    10·1 answer
  • What are some things that have contributed to increased global temperatures due to higher levels of carbon dioxide?
    9·1 answer
  • PLEASE HELP IBEG YOU I REALLY NEED HELP LEASE HELP ME I BGE OYU
    8·1 answer
  • Energy to us in Biology is the ability to do what?​
    11·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Ecological succession is typically a _______ process through which a developing ecosystem becomes _______ stable.
    13·1 answer
  • List two examples of an abiotic factor and a biotic factor interacting.
    5·2 answers
  • Why tides<br> can be a<br> reliable &amp;<br> predictable<br> source of<br> energy?
    15·1 answer
  • What is dispersal of seeds <br>​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!