1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cricket20 [7]
3 years ago
14

How many grains of pollen does it take to fertilize an egg in a flower?

Biology
2 answers:
PolarNik [594]3 years ago
6 0

it only need one to fertilize a egg in a flower

mafiozo [28]3 years ago
6 0
This should help you.

You might be interested in
You stumble upon a plant while on a walk that has flowers, and cut open one of the shoots to find ringed vascular bundles. What
ololo11 [35]

The type of plant is dicot plant that has  ringed vascular bundles.

Vascular bundles are a collection of tube-like tissues that go with the flow through plant life, transporting vital substances to diverse parts of the plant. Xylem transports water and vitamins, phloem transports natural molecules, and cambium is worried in plant growth.

Inside the dicot stem, the vascular bundles are arranged in a hoop, with pith focused at the core of the stem, rather than being scattered in the course of the plant interior. In each vascular package deal, the xylem and phloem are separated via a substance known as vascular cambium.

A vascular bundle is part of the delivery machine in vascular vegetation. The shipping itself occurs in the stem, which exists in  bureaucracy: xylem and phloem. both those tissues are found in a vascular bundle, which similarly will encompass supporting and protective tissues.

Learn more about vascular bundles here:-brainly.com/question/2278934

#SPJ4

3 0
2 years ago
The portion of a sperm cell that contains digestive enzymes for penetrating the egg is called __________.
lyudmila [28]
The portion of a sperm cell that contains digestive enzymes for penetrating he egg is called the acrosome.
I hope this helps.
8 0
3 years ago
Think of an object , person or place at home that functions similar to the chloroplast.
vlada-n [284]

Answer:

a genarater powers a home

Explanation:

7 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Which of the following mush an animal do to survive?!
-Dominant- [34]
They must find food 
they must find shelter 

3 0
3 years ago
Other questions:
  • Real life example of chloroplasts
    15·1 answer
  • Which of the strands use a template for dna replication? question 2 choices choice
    13·1 answer
  • BRAINLIESTTTTT ASAP!
    5·1 answer
  • Allele definition...
    8·2 answers
  • Is Jamall correct why or why not
    10·1 answer
  • How is conservation related to biodiversity?
    13·1 answer
  • In which range of time do mountains form? A. days B. millions of years C. months D. seconds
    6·2 answers
  • Fossils in _______ layers of rock are generally estimated to be _______ than fossils found in the deeper layers. (3 points)
    11·2 answers
  • Lactase is classified as which of the following macromolecules?
    5·1 answer
  • Rocks are classified as igneous, metamorphic, or sedimentary according to?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!