Answer:
The phylogenetic graph uses several types of variables to be formed, while other models use only one type of variable.
Explanation:
To create a phylogenetic chart, matrices with data on the studied species are used. These data are composed of morphological, chemical and / or genetic information that allow a detailed investigation about the ancestry of each species, in addition to allowing the correct grouping based on this ancestry and evolution.
A phylogenetic graph is different from other molecular models due to the number of data considered by it, since other models, such as the molecular clock, for example, only consider genetic based information.
Answer: [D]: "oceans" .
_______________________________________
Note: Among the answer choices given—{aquifers, glaciers, lakes, oceans}—oceans are the saltiest (VERY salty—requiring "desalination" in order to obtain potable water.
________________________________________
There are 3 main processes in urine formation. These are Filtration, reabsorption and secretion.
Filtration
Blood enters the afferent arteriole and goes to glomerulus where blood is filtered and it will sip inside the glomerulus and nonfilterable components will go into efferent arteriole.
Reabsoprtion
Molecules and ions will be reabsrobed into the system. The fluid will pass into the proximal, distal and convoluted tubules, loop of henle, as water an ions are removed as the fluid osmolarty changes. Last is secretion of substance that is not filtered.
Many scientist believe it is correct so option C
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation: