1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
uysha [10]
3 years ago
9

When preparing to measure the vital signs of a patient?

Biology
1 answer:
vladimir2022 [97]3 years ago
6 0
For the answer to the question above asking When preparing to measure the vital signs of a patient?  First, <span>observe the patient's chest movements while appearing to assess his pulse.
I hope my answer helped you. Feel free to ask more questions. Have a nice day!</span>
You might be interested in
Part E Your molecular clock model resembles another branching chart, the phylogenetic chart, which you’ve used in this unit. Rev
Nikitich [7]

Answer:

The phylogenetic graph uses several types of variables to be formed, while other models use only one type of variable.

Explanation:

To create a phylogenetic chart, matrices with data on the studied species are used. These data are composed of morphological, chemical and / or genetic information that allow a detailed investigation about the ancestry of each species, in addition to allowing the correct grouping based on this ancestry and evolution.

A phylogenetic graph is different from other molecular models due to the number of data considered by it, since other models, such as the molecular clock, for example, only consider genetic based information.

4 0
3 years ago
Desalination is needed in order to obtain potable water from _____.
Vinvika [58]
Answer:  [D]:  "oceans" .
_______________________________________
Note:  Among the answer choices given—{aquifers, glaciers, lakes, oceans}—oceans are the saltiest (VERY salty—requiring "desalination" in order to obtain potable water.
________________________________________
4 0
3 years ago
Read 2 more answers
Describe the flow of glomerular filtrate from its formation in bowman's capsule till it exits the body as urine
SOVA2 [1]
There are 3 main processes in urine formation. These are Filtration, reabsorption  and secretion. 
Filtration
Blood enters the afferent arteriole and goes to glomerulus where blood is filtered and it will sip inside the glomerulus and nonfilterable components will go into efferent arteriole.

Reabsoprtion
Molecules and ions will be reabsrobed into  the system. The fluid will pass into the proximal, distal and convoluted tubules, loop of henle, as water an ions are removed as the fluid osmolarty changes. Last is secretion of substance  that is not filtered.




8 0
3 years ago
Which of these is an important characteristic of a scientific theory?
Tamiku [17]

Many scientist believe it is correct so option C

3 0
3 years ago
Read 2 more answers
Which mrna sequences would form a structure that is a cue for transcription termination of some genes?
torisob [31]

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

5 0
2 years ago
Other questions:
  • Order the steps that occur as a protein is synthesized within a cell and finally excreted for use outside of the cellITEMMove Bo
    13·2 answers
  • Which sources of nutrient pollution are mentioned and shown in the video? Check all that apply.
    12·2 answers
  • The heart is composed of 2 pumps. the right side pumps blood to ________ and the left side pumps blood to ______.
    9·1 answer
  • How much of the suns engry do mushrooms take!!!!!
    12·1 answer
  • Many species of gulls feed their chicks by regurgitating food. When parents return from foraging, the gull chicks peck at a red
    14·1 answer
  • Organisms that rely on other organisms for the energy sources are known
    5·1 answer
  • Two organisms evolved from a common ancestor. Which process best explains why they now have different characteristics? *
    10·1 answer
  • The pancreas produces enzymes and _________
    5·2 answers
  • Fill in the blank:
    12·1 answer
  • The graph demonstrates the quantitative variation for skin pigmentation.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!