1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga55 [171]
3 years ago
15

The gene for melanin (skin pigment) is transcribed similarly in humans and apes. Where does the transcription of the melanin gen

e take place?
A.In the nucleus

B.In the nucleus and the cytoplasm

C.In the Ribosome

D.Only in the nucleus
Biology
1 answer:
vfiekz [6]3 years ago
7 0

D. only in the nucleus. DNA or (deoxyribonucleic acid) is what makes you... YOU! All of your traits (Hair color, Eye color, The shape of your ears, Cancer risk, SKIN COLOR, etc.) But DNA is only housed in the nucleus of the cell, so the nucleus is the only place  the transcription of the melanin gene could take place.

You might be interested in
What does the term hydrophobic mean? A. Attracts water B. Repels Water C. More energy D. Less energy
Degger [83]
The word “hydro” means water and “phobic” means away or repel. So, the correct answer would be B, Repels Water
4 0
2 years ago
Which are the most abundant elements in the bio molecules?
Svetllana [295]

Answer:

carbon, hydrogen, nitrogen, oxygen, phosphorus, and sulfur

3 0
3 years ago
Read 2 more answers
How do the unsaturated fatty acids in phospholipids affect the structure of cell membranes?
ludmilkaskok [199]

Unsaturated fatty acids are a component of the phospholipids in cell membranes and help maintain membrane fluidity. The Phospholipids contain a variety of unsaturated fatty acids, when compressed, the “kinks” in their tails push adjacent phospholipid molecules away, that helps in maintain fluidity in the membrane. Unsaturated fatty acids have at least one double bond, creating a "kink" in the chain, the absence of double bonds decreases fluidity, making the membrane very strong and stacked tightly.

The ratio of saturated and unsaturated fatty acids determines the fluidity in the membrane at a temperature, at appropriate temperatures the phospholipids have enough kinetic energy to overcome the intermolecular forces holding the membrane together, which increases membrane fluidity.

To learn more about Unsaturated fatty acids , here

brainly.com/question/4891995

#SPJ4

4 0
1 year ago
Explain the cellular functions that occur when antibiotics attacks a bacteria cell
Vlad [161]

Answer:

Antibiotics target the cell wall, cell membrane, and the processes of protein and nucleic acids production in bacteria to rupture the cell..

Explanation:

6 0
2 years ago
Describe five cultural or societal values (anything to do with humans except economy) of an estuary
pochemuha

The five major types of estuaries classified by their geology are coastal plain, bar-built, deltas, tectonic and fjords. In geologic time, which is often measured on scales of hundreds of thousands to millions of years, estuaries are often fleeting features of the landscape.

8 0
2 years ago
Read 2 more answers
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Valence is the number of electrons an atom must gain or lose in order to _____ its outer shell or have a stable octet in its out
    5·2 answers
  • Biologists use their observations on a small island to construct the food web shown. Their calculations indicate that the produc
    9·1 answer
  • What are some uses of analyzing karyotypes?
    9·1 answer
  • A racecar begins its first lap on a racetrack. After seven seconds, it is 140 meters further east. What is the average velocity
    12·1 answer
  • Explain the biological significance of mitosis
    11·2 answers
  • Climate change is having a great impact on the Arctic food web on land and on the ice. The animals most at risk from a warming p
    15·1 answer
  • In humans, the trait for tongue rolling is dominant over the trait for the inability of a human to roll his/her tongue. If a het
    15·1 answer
  • Which statements describe a mushroom’s niche? Check all that apply.
    5·2 answers
  • What is the purpose of the biogeochemical cycles?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!