1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
skelet666 [1.2K]
2 years ago
9

Where do plants get the nitrogen they need to create amino acids and DNA?

Biology
2 answers:
9966 [12]2 years ago
7 0

Answer:

Plant's get the nitrogen they need from the soil.

Explanation:

Sholpan [36]2 years ago
5 0

Answer:From the sun

Explanation:

You might be interested in
Study the following food chain : grass>rabbits>snakes>hawks.From this chain, you can correctly assume that each populat
masha68 [24]
The answer is D, for when one tropic level is eaten by the tropic level above it, the tropic level is supporting the higher one. I. E. Rabbits are supported by the grass because rabbits eat the grass. Also, the grass population would be larger than rabbits, the rabbits larger than snakes, so on and so forth, so B is ruled out. B states that each population is larger than the one BEFORE it, but there is no way there would be more rabbits than grass. Also, there are both herbivores and carnivores in the food chain, so A and C are out. The best answer is D.
8 0
3 years ago
Which is more likely to happen? Two genes on the same chromosome being inherited, or two genes on different chromosomes being in
mixas84 [53]

Answer:

Two genes on the same chromosome being inherited.

Explanation:

6 0
3 years ago
Lower-body obesity significantly increases one's risk for chronic disease. lower-body obesity significantly increases one's risk
balandron [24]
The awnser would be false 
3 0
3 years ago
I need get a , a on this or I’m failing lol please help
Ierofanga [76]

Answer:

I think the answer is B, Rivers. Mountain ranges don't really help the environment much as can mostly only change the climate.

8 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • Which kingdom(s) include organisms that are autotrophic or heterotrophic?
    13·1 answer
  • The product of body weight and percent fat is known as ____.​
    10·1 answer
  • A marine ecosystem off the California coast consists of leatherback turtles that feed on jellyfish, and killer whales that prey
    7·2 answers
  • The picture below shows the skeleton of an extinct mammal.
    13·1 answer
  • Does species are largest unit of life?​
    14·2 answers
  • if a space probe sends back information on an object traveling through space at close speed of light , astronomers will be worki
    6·1 answer
  • The nurse is assessing children at risk for phenylketonuria (pku). which child is at greatest risk?
    14·1 answer
  • ANSWER FOR BRAINLIEST QUICK PLEASE.
    13·1 answer
  • What does the e symbol represent. I will mark brainliest
    6·1 answer
  • Pepsin and Trypsin are enzymes. At what pH do they have the highest rate of reaction?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!