1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KengaRu [80]
3 years ago
12

Complete the Concept Map to describe embryonic development including the formation of the primary germ layers and the extraembry

onic membranes.
Drag the appropriate labels to their respective targets
1. allantois and yolk sac
2. hypoblast cells
3. piblast cells
4. blastocyst
5. mesodernm
6. chorion
7. amnion
8. ectodermm
9. endoderm
A. include(s) the outer B. form(s) a bilayered C. form(s) a bilayered
trophoblast, which help embryonic disc, one layer embryonic disc, one
form extraembryonic of which is made of(s):_____ layer of which is made of:_______
membrane(s) called the:_____

Biology
1 answer:
Rudiy273 years ago
4 0

Answer:

The correct answer is given below and attached as an image as well.

Explanation:

Blastocyst forms during the stage early embryonic developmental of mammals. The outer cell layer of the blastocyst is known as trophoblast. This outer cell layer gives rise to extra-embryonic membrane - chorion.

The epiblast leads to the development of ectoderm, mesoderm, endoderm known as the three germ layers. It also forms an extra-embryonic layer called the ambion.  Yolk sac and allantois are formed with the help of hypoblast.

You might be interested in
A researcher investigates a recently discovered species of plant. The plant has vascular tissues and exhibits a sporophyte and a
CaHeK987 [17]
<h3><u>Answer</u>;</h3>

D. pteridophyte

<h3><u>Explanation;</u></h3>
  • <em><u>Pteridophyte are vascular plants in the phylum plants that reproduce by releasing spores rather than seeds. </u></em>

Other characteristics of pteridophyte includes;

  • <em><u>They show alternation of generations, that is the sporophyte generation and gametophyte generation are observed.</u></em>
  • <em><u>Sporophytes has true roots, stem and leaves</u></em>
  • <em><u>Sporangia are produced in groups on sporophylls</u></em>

7 0
4 years ago
Read 2 more answers
If the amount of water vapor in the air increases, then the dew point of the air will
goldenfox [79]

Answer: decrease

The temperature at which the air needs to be cooled down at constant pressure, the water content reaches saturation is called as dew point. At this point the the relative humidity of air is 100%. The air cools to form liquid water. In the dew point the temperature of the air decreases so that the air cools down to form water in the form of dew.

8 0
4 years ago
When a mouse eats grass only 10% of the energy from the plant is transferred to the mouse what happens to the other 90%
Mars2501 [29]
It’s possible the other 90% was excreted ? Because a lot of the energy may not be useful to the mouse’s system. ... hmmm. That’s all I could think of, sorry I can’t be a better help ;w;
3 0
4 years ago
How has the sellement et humans in agricultural societies impacted the environment?
ValentinkaMS [17]

Answer:

They have increased the amount of certain organisms (a lot of crops and such) and made the soil healthier. Also, other organisms that may feed on this are having more food.

Explanation:

5 0
4 years ago
What would happen if decomposition did not occur?
kifflom [539]
There would be things everywhere because it didn't decompose ex. orange peels, banana
6 0
4 years ago
Other questions:
  • How many chromosomes are present in a human Ovum
    10·1 answer
  • What is cartilage composed of?
    7·1 answer
  • What makes a dominant allele different from a recessive allele?
    5·2 answers
  • Can someone please help me . WIL MARK BRAINLIEST !!
    9·1 answer
  • The image shows a type of stress.
    15·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Ciclo del fosforo, la importancia
    12·1 answer
  • Which of the following include all the others?
    12·1 answer
  • A chromosome has an inversion.which describes a pericentric inversion
    9·1 answer
  • How is a chemical equation
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!