Reproductive system is your answer.
Answer: True, both of the given statements are true.
Explanation:
1. Nearly all the environment contains microorganism whether it is soil, air, water or any other surface. They have the ability of live in the extreme conditions.
There are different forms of bacteria found at different places. Some of them are thermophiles that at found in extremely hot conditions such as thermal vents.
The organism like Psychrophiles are the microorganisms that have the ability to survive at lower temperatures. Example: bacteria found in polar regions.
2. A culture can be defined as a pure culture if it has an unadulterated species of bacteria. It has no contamination and if a small inoculum from the pure sample is streaked on a plate then a pure culture of the sample is obtained.
This should be done in an aseptic condition so that the bacterial species should be free from contamination.
A layer of smooth cartilage at their ends, which cushions the bones and prevents them from rubbing directly against one another. The whole joint is also enclosed in a synovial capsule, which is full of synovial fluid. The synovial fluid acts like the oil in an engine, lubricating the joint and preventing the cartilage from becoming worn down.
Acidic substance(s):
Vinegar contain acetic acid
Tomato Juice contain citric acid
Basic substance(s):
Baking Soda contains Sodium Carbonate
Neutral Substance(s):
In the process of producing sugar, the sugar cane juice is acidic but goes through a process where it's acidity is neutralized and as such the crystalline sugar ends up neutral
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
