1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aivan3 [116]
3 years ago
13

Signs and symptoms of sudden illness do not include:

Biology
2 answers:
lana [24]3 years ago
4 0

Answer: The correct answer is c. Bruising or rigidness of the abdomen.

Certain sudden illness can be related to chronic diseases of heart and lung infection.

Some of the common symptoms of sudden illness include dizziness, drowsiness, and unconsciousness. Signals of stroke or brain attack or cerebrovascular attack, shock or heart attack can occur. There can be blurred vision, sweating, nausea or vomiting, seizures, and diarrhea.

There is no symptom of bruising or rigidness of the abdomen in case of sudden common illness mentioned here.

natta225 [31]3 years ago
3 0
I believe the answer is A.
You might be interested in
Even though scorpions are related to spiders, there are many differences between the two
Dmitrij [34]

Answer:

Cell differentiation

Explanation:

Cell differentiation is common with multicellular organisms. It is the process by which a cell changes from one cell form to another. Cell differentiation makes the change from a zygote to a complex system with different parts.Cells which have been differentiated also becomes specialized. Complex multicellular animals and plants would not be in existence without specialization. This is because cells have specialized functions and each cell is very important to the survival of the organism.

7 0
3 years ago
Describe the most common molecular mechanism for recessively inherited human genetic diseases such as cystic fibrosis.
Marta_Voda [28]

Answer:

Explanation:

cystic fibrosis is an autosomal recessive disorder. When the child receives the defective gene from both of his parents, he suffers from cystic fibrosis. Because his parents are carriers. In recessive genetic disorder, the genes will be expressed when both recessive genes are present in one person. The person suffering from this disease have a lung infection and pancreatic dysfunction.  

In this cystic fibrosis, genes are located in chromosome 7. The effective gene is the CFTR gene. The CFTR gene is present in the DNA and by transcription, this forms CFTR protein. This is a channel protein and transports chloride ion.

This CFTR protein transports chloride ions and it makes a balance in the cell membrane. These genes are commonly present in the epithelial cells. Outside the epithelial mucus is present to keep the cells moist.

The epithelium gets a lack of water and chloride due to the defect. Therefore cells need CFTR proteins also. This causes lung infection and pancreatic disorder.

6 0
3 years ago
PLS HELP! ILL GiVE BRAINLIEST!!! LI NK IS BELOW!! JUST COPY AND PASTE IT!!
Anastasy [175]

Explanation:

no link. sorry I can't help

6 0
3 years ago
Read 2 more answers
Neurotransmission can best be described as a(n)
MariettaO [177]
C? Hope I’m right
Jdvdheuwvwjwgecrkfgb
3 0
3 years ago
HURRY PLEASE
masya89 [10]
The answer will be Goddess
3 0
2 years ago
Other questions:
  • The body has natural defense mechanisms against disease. Which of the following is not a natural defense mechanism? white blood
    9·1 answer
  • What is the best description of chromosomes by the end of anaphase II of meiosis?
    10·1 answer
  • Signals are sent from one neuron to another by jumping across a tiny space known as what
    8·1 answer
  • When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
    5·1 answer
  • Which of the following is a negative side effect of burning oil?
    5·1 answer
  • A sequence of organisms, each of which serves as a source of nutrients or energy for the next, is called a(n) __________________
    5·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • What are the finger-like extensions in this part that actually absorbs the nutrients?
    15·1 answer
  • which explanations accurately describe how cell structures interact in order to maintain homeostasis? select all that apply.
    15·1 answer
  • What are some examples of structural and behavioral adaptations
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!