The first open releasing the energy of glucose in the cell is known as

Biology

1 answer:

poizon [28]3 years ago

4 0

The first open releasing the energy of glucose in the cell is known as Glycolysis.

You might be interested in

Do you think that fungal cells have turgor pressure? Design an experiment to test your hypothesis.

valentinak56 [21]

Yes because they still need water to function. Fungal cells are interesting in that they have a cell wall like plant cells, but that cell wall ismade up of chitin.They are also heterotrophic, normally feeding on dead organic material. Hope it helps.

3 0

2 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Tip or up vote true or false Evolution is accepted by most scientists as a fact of nature.

stira [4]

This answer
would be true

3 0

3 years ago

Which describes a grizzly bear’s habitat?

beks73 [17]

The physical area where the bear lives describes a grizzly bear’s habitat because habitat is the natural home or environment of an animal.

D.The physical area where the bear lives

6 0

3 years ago

Please help

xz_007 [3.2K]

Answer:

your a parasite.

Explanation:

4 0

2 years ago

Read 2 more answers